Copyright
©2014 Baishideng Publishing Group Co.
World J Gastroenterol. Jan 7, 2014; 20(1): 219-227
Published online Jan 7, 2014. doi: 10.3748/wjg.v20.i1.219
Published online Jan 7, 2014. doi: 10.3748/wjg.v20.i1.219
Table 1 Primer sequences for the analysed variants
Gene | SNP | Primers (5’-3’) |
IL23R | rs1004819 | Forward: GCATTCTAGGACCGTTTTGG |
Reverse: ATCTGGTGGAAATATGTGAAACCTA | ||
IL23R | rs2201841 | Forward: GGCAAAAGGGAATTGAGAGG |
Reverse: GGCCTATGATTATGCTTTTTCCTG1 | ||
SLC22A4 | rs1050152 | Forward: AGAGAGTCCTCCTATCTGATTG |
Reverse: TCCTAGCTATTCTTCCATGC | ||
SLC22A5 | rs2631367 | Forward: GCCGCTCTGCCTGCCAGC |
Reverse: GGTCGCTATCAGGAACACGGAGGA | ||
IGR2230a_1 | rs17622208 | Forward: CAGAAGAATGCCCTTGATGTG |
Reverse: TCAGAAGCTGTCCATCCCAC | ||
IGR2198a_1 | rs11739135 | Forward: AGACACTGGGACATCATCTGTCTG |
Reverse: GGGCAATTCTATGAGGACATTTAGA | ||
IGR2096a_1 | rs12521868 | Forward: CAAGATTTCTGCCATAGCCTCCT |
Reverse: GGAGGGTGGTGTAGCCAGAGTAG |
Table 2 Case-control genotypes and allele frequencies of variants in IL23R and inflammatory bowel disease-5 locus n (%)
UC (n = 320) | Controls (n = 316) | OR (95%CI)1 | P value | |
IL23R (rs1004819) | ||||
GG | 126 (39.4) | 158 (50.0) | ||
GA | 168 (52.5) | 134 (42.4) | ||
GA + AA | 194 (60.6) | 158 (50.0) | 1.606 (1.160-2.223)a | 0.004a |
AA | 26 (8.1) | 24 (7.6) | 1.254 (0.696-2.261) | 0.452 |
RAF | 0.343 | 0.287 | 0.032a | |
IL23R (rs2201841) | ||||
TT | 140 (43.8) | 155 (49.1) | ||
TC | 150 (46.9) | 143 (45.3) | ||
TC + CC | 180 (56.3) | 161 (51.0) | 1.268 (0.920-1.749) | 0.147 |
CC | 30 (9.4) | 18 (5.7) | 1.983 (1.069-3.678)a | 0.030a |
RAF | 0.328 | 0.283 | 0.242 | |
SLC22A4 (rs1050152) | ||||
CC | 93 (29.1) | 110 (34.8) | ||
CT | 159 (49.7) | 148 (46.8) | ||
CT + TT | 227 (71.0) | 206 (65.2) | 1.319 (0.935-1.86) | 0.115 |
TT | 68 (21.3) | 58 (18.4) | 1.150 (0.768-1.723) | 0.498 |
RAF | 0.46 | 0.417 | 0.120 | |
SLC22A5 (rs2631367) | ||||
GG | 83 (25.9) | 89 (28.2) | ||
GC | 163 (50.9) | 156 (49.4) | ||
GC + CC | 237 (74.0) | 227 (71.9) | 1.138 (0.794-1.631) | 0.481 |
CC | 74 (23.1) | 71 (22.5) | 0.982 (0.669-1.440) | 0.925 |
RAF | 0.485 | 0.471 | 0.607 | |
IGR2230a_1 (rs17622208) | ||||
GG | 87 (27.2) | 90 (28.5) | ||
AG | 160 (50.0) | 157 (49.7) | ||
AG + AA | 233 (72.8) | 226 (71.5) | 1.073 (0.751-1.532) | 0.698 |
AA | 73 (22.8) | 69 (21.8) | 0.990 (0.673-1.457) | 0.960 |
RAF | 0.478 | 0.466 | 0.685 | |
IGR2198a_1 (rs11739135) | ||||
GG | 105 (32.8) | 117 (37.0) | ||
GC | 159 (49.7) | 150 (47.5) | ||
GC + CC | 215 (67.2) | 199 (63.0) | 1.260 (0.900-1.763) | 0.179 |
CC | 56 (17.5) | 49 (15.5) | 1.169 (0.760-1.797) | 0.477 |
RAF | 0.423 | 0.392 | 0.260 | |
IGR2096a_1 (rs12521868) | ||||
GG | 101 (31.6) | 117 (37.0) | ||
GT | 164 (51.3) | 147 (46.5) | ||
GT + TT | 219 (68.5) | 199 (63.0) | 1.256 (0.897-1.760) | 0.185 |
TT | 55 (17.2) | 52 (16.5) | 1.045 (0.680-1.608) | 0.840 |
RAF | 0.428 | 0.397 | 0.262 |
Table 3 Pairwise analysis of interactions of IBD5 and IL23R to risk of ulcerative colitis
Model | OR (95%CI) | P value |
IL23R rs1004819 * IGR2230a_1 | 1.266 (0.627-2.553) | 0.51 |
IL23R rs1004819 * IGR2198a_1 | 1.383 (0.711-2.690) | 0.340 |
IL23R rs1004819 * IGR2096a_1 | 0.942 (0.625-1.420) | 0.776 |
IL23R rs1004819 * SLC22A4 | 1.017 (0.516-2.002) | 0.962 |
IL23R rs1004819 * SLC22A5 | 1.116 (0.549-2.270) | 0.761 |
IL23R rs2201841 Ho* IGR2230a_1 | 0.316 (0.080-1.247) | 0.100 |
IL23R rs2201841 Ho* IGR2198a_1 | 0.388 (0.105-1.430) | 0.155 |
IL23R rs2201841 Ho* IGR2096a_1 | 0.413 (0.117-1.458) | 0.169 |
IL23R rs2201841 Ho* SLC22A4 | 0.118 (0.095-1.301) | 0.352 |
IL23R rs2201841 Ho* SLC22A5 | 0.298 (0.075-1.179) | 0.084 |
Table 4 Genotype-specific ulcerative colitis odds ratios (with 95%CI) for combinations of variants in IL23R and IBD5
SLC22A4 | SLC22A5 | IGR2230a_1 | IGR2198a_1 | IGR2096a_1 | ||||||
CC | CT + TT | GG | GC + CC | GG | AG + AA | GG | GC + CC | GG | GT + TT | |
IL23R rs1004819 | ||||||||||
GG | 1 | 1.298 | 1 | 1.064 | 1 | 0.941 | 1 | 1.033 | 1 | 1.104 |
(0.782-2.156) | (0.623-1.815) | (0.556-1.593) | (0.623-1.711) | (0.666-1.831) | ||||||
P = 0.313 | P = 0.821 | P = 0.822 | P = 0.900 | P = 0.702 | ||||||
GA + AA | 1.527 | 12.015 | 1.424 | 11.691 | 1.300 | 1.549 | 1.263 | 11.803 | 1.281 | 11.911 |
(0.872-2.673) | (1.230-3.300) | (0.776-2.614) | (1.003-2.821) | (0.716-2.359) | (0.927-2.588) | (0.736-2.166) | (1.096-2.966) | (0.744-2.206) | (1.162-3.143) | |
P = 0.138 | P = 0.005 | P = 0.253 | P = 0.048 | P = 0.388 | P = 0.093 | P = 0.396 | P = 0.020 | P = 0.372 | P = 0.010 | |
IL23R rs2201841 | ||||||||||
TT+TC | 1 | 1.328 | 1 | 1.254 | 1 | 1.184 | 1 | 1.296 | 1 | 1.385 |
(0.989-1.927) | (0.868-1.812 | (0.823-1.704) | (0.922-1.822) | (0.982-1.953) | ||||||
P = 0.058 | P = 0.228 | P = 0.363 | P = 0.136 | P = 0.063 | ||||||
CC | 13.413 | 1.716 | 13.946 | 1.474 | 13.777 | 1.411 | 13.165 | 1.592 | 12.977 | 11.701 |
(1.169-9.965) | (0.788-3.739 | (1.232-12.645) | (0.679-3.200) | (1.181-12.084) | (0.652-3.056) | (1.088-9.206) | (0.735-3.449) | (1.099-8.066) | (0.765-3.784) | |
P = 0.018 | P = 0.171 | P = 0.014 | P = 0.324 | P = 0.018 | P = 0.381 | P = 0.027 | P = 0.236 | P = 0.026 | P = 0.189 |
- Citation: Sarlos P, Varszegi D, Csongei V, Magyari L, Jaromi L, Nagy L, Melegh B. Susceptibility to ulcerative colitis in Hungarian patients determined by gene-gene interactions. World J Gastroenterol 2014; 20(1): 219-227
- URL: https://www.wjgnet.com/1007-9327/full/v20/i1/219.htm
- DOI: https://dx.doi.org/10.3748/wjg.v20.i1.219