Comparison of bacterial quantities in left and right colon biopsies and faeces

Table 1 Demographic and clinical characteristics of study subjects

Patient No.	Age	Gender	Days passed1	Reason for referral to colonoscopy	Diverticulosis
1	53	F	105	Iron deficiency anaemia	Yes
2	41	M	NA	Constipations	No
3	43	M	NA	Functional diarrhoea	No
4	64	M	98	IBS	No
5	85	M	NA	Rectal bleeding	Yes
6	75	M	15	Iron deficiency anaemia	Yes
7	63	M	NA	IBS	No
8	62	F	29	IBS, constipation	No
9	81	M	NA	Iron deficiency anaemia	Yes
10	72	F	23	IBS, diarrhoea	Yes
11	41	F	21	Rectal bleeding	Yes
12	74	F	26	Iron deficiency anaemia	Yes
13	75	F	26	Follow-up after diverticulitis	Yes
14	68	F	19	IBS, diarrhoea	No
15	47	F	19	Follow-up after diverticulitis	Yes
16	80	F	32	Iron deficiency anaemia	Yes
17	54	M	NA	Rectal bleeding	No
18	57	F	21	Rectal bleeding	Yes
19	33	F	24	Diffuse abdominal pain	No
20	51	F	28	Rectal bleeding	No

¹From colonoscopy to faeces sampling. F: Female; M: Male; NA: Not analysed; IBS: Irritable bowel syndrome.

Table 2 Real-time polymerase chain reaction primers, probes and assay conditions

qPCR assay	Primers	Chemistry1	Annealing temperature (°C)	Standard species	Primer reference	Reaction condition reference
Akkermansia muciniphila	CAGCACGTGAAGGTGGGGAC	FAST SYBR Green Mastermix;	58	Akkermancia muciniphila ATCC BAA-835	Png et al[20]	This study
	CCTTGCGGTTGGCTTCAGAT	300 nmol/L each primer
Bacteroidetes	GGCGACCGGCGCACGGG	Power SYBR Green Mastermix;	65	Bacteroides fragilis	Nakanishi et al[21]	This study
	GRCCTTCCTCTCAGAACCC	300 nmol/L each primer		ATCC 25285
Bifidobacterium spp.	CCTGGTAGTCCACGCCGTAA	FAST TaqMan Mastermix;	60	Bifidobacterium adolescentis	Mäkivuokko et al[22]	Mäkivuokko et al[22]
	CAGGCGGGATGCTTAACG	300 nmol/L each primer,		JCM 1275
	ATCCAGCATCCACCG
		200 nmol/L probe
Clostridium cluster IV	GCACAAGCAGTGGAGT	SYBR Green Core Reagents; 1.5 nmol/L MgCl2, 250 nmol/L each primer	62	Clostridium leptum	Matsuki et al[23]	This study
	CTTCCTCCGTTTTGTCAA			DSM 753
Clostridium cluster XIVab	GAWGAAGTATYTCGGTATGT	Power SYBR Green Mastermix;	52	Clostridium boltae	Song et al[24]	Lahtinen et al[25]
	CTACGCWCCCTTTACAC	300 nmol/L each primer		DSM 15670
	Clostridium difficile			TTGAGCGATTTACTTCGGTAAAGA			FAST SYBR Green Mastermix;	60	Clostridium difficile	Lahtinen et al[25]	Lahtinen et al[25]
CCATCCTGTACTGGCTCACCT		300 nmol/L each primer	ATCC 9689
Collinsella aerofaciens	CCCGACGGGAGGGGAT	Power SYBR Green Mastermix;	60	Collinsella aerofaciens ATCC25986	Kassinen et al[26]	This study
	CTTCTGCAGGTACAGTCTTGA	300 nmol/L each primer
Domain bacteria	CATRGHYGTCGTCAGCTCGT	FAST SYBR Green Mastermix;	60	Enterococcus faecium	This study	This study
	GCGGTGTGTRCAAGRCCC	200 nmol/L each primer		DGCC 2063
Enterobacteriaceae	TGCCGTAACTTCGGGAGAAGGCA	SYBR Green Core Reagents;	58	Enterococcus faecium DGCC2063	Matsuda et al[27]	This study
	TCAAGGACCAGTGTTCAGTGTC	2 nmol/L MgCl2,
		200 nmol/L each primer
	Escherichia coli						ACTGGAATACTTCGGATTCAGATACGT	FAST TaqMan Mastermix;	60	Escherichia coli ATCC 11775	Kaclíková et al[28]	This study
ATCCCTACAGATTCATTCCACGAAA		100 nmol/L each primer, 30 nmol/L probe
fam-CAGCAGCTGGGTTGGCATCAGTTATTCG-tamra
Faecalibacterium prausnitzii	CCCTTCAGTGCCGCAGT	SYBR Green Core Reagents;	62	Faecalibacterium prausnitzii ATCC 27768	Rinttilä et al[16]	This study
	GTCGCAGGATGTCAAGAC	4 nmol/L MgCl2,
		250 nmol/L each primer
	Human GAPDH						GGTAAGGAGATGCTGCATTCG	Power SYBR Green Mastermix;	60	Human DNA	Png et al[20]	This study
CGCCCAATACGACCAAATCTAA		300 nmol/L each primer
Helicobacterium pylori			GAAGATAATGACGGTATCTAACGAATAA	FAST SYBR Green Mastermix;	58	Helicobacter pylori	Modified from Rinttilä et al[16]	This study
	CATAGGATTTCACACCTGACTGACTAT	400 nmol/L each primer
Staplylococcus aureus	GCGATTGATGGTGATACGGTT	Power SYBR Green Mastermix;	60	Staphylococcus aureus	Brakstad et al[29]	This study
	AGCCAAGCCTTGACGAACTAAAGC	300 nmol/L each primer		ATCC 29213
Veillonella	AYCAACCTGCCCTTCAGA	Power SYBR Green Mastermix;	60	Veillonella parvula	Rinttilä et al[16]	This study
	CGTCCCGATTAACAGAGCTT	200 nmol/L each primer		DSM 2008

¹Manufactured by (Applied Biosystems, Foster City, CA). GAPDH: Glyceraldehyde 3-phosphate dehydrogenase; qPCR: Quantitative polymerase chain reaction.

Table 3 Pearson correlations between sample types

Bacterial group/study period	Right colon vs left colon		Right colon vs faecal sample		Left colon vs faecal sample
	Correlation coefficient	P value	Correlation coefficient	P value	Correlation coefficient	P value
Akkermansia muciniphila	0.14	0.63	-0.01	0.97	0.36	0.26
Bacteroidetes	0.61	0.02	0.45	0.12	0.17	0.61
Bifidobacterium	0.71	0.01	0.62	0.04	0.81	0.00
Clostridium Cluster IV	0.26	0.39	0.26	0.44	0.17	0.64
Clostridium Cluster XIVab	0.71	0.00	0.54	0.06	0.50	0.09
Collinsella aerofaciens	0.38	0.25	0.63	0.13	-0.87	0.13
Eubacteria	0.19	0.52	0.01	0.97	-0.31	0.33
Enterobacteriaceae	0.38	0.20	0.59	0.03	0.31	0.35
Faecalibacterium prausnitzii	0.55	0.04	0.76	0.00	0.28	0.38
Veillonella	0.33	0.46	0.64	0.09	0.46	0.54

Significant correlations (P < 0.05) are designated with bold font.