Juvenile ferric iron prevents microbiota dysbiosis and colitis in adult rodents

Table 1 Primers used for real-time polymerase chain reaction amplification of 16S rRNA gene

PCR assay	Primers	Primers Sequences 5’→3’	Accession number (NCBI)	Linear regression curves with coefficient of correlation	Sources of reference
Total Bacteria	UnivF	TCCTACGGGAGGCAGCAGTG	-	Y = -2.941 x + 36.580	Watanabe et al[21], 2001
	UnivR	TTACCGCGGCTGCTGGCACG		r² = 0.9997	Nadkarni et al[22], 2002
Bacteroidetes	BacF	CCTWCGATGGATAGGGGTT	-	Y = -2.908 x + 35.839	Firmesse et al[23], 2008
	BactR	TCCCCAGGTGGAATACTTAACG		r² = 0.9995
Enterobacteria	EntF	CATTGACGTTACCCGCAGAAGAA	AX110239/AX109631	Y = -3.192 x + 36.762	This study
	EntR	CGCTTGCACCCTCCGTATTA	AF293850/U26176	r² = 0.9747
Firmicutes	FirmF	ACCCGCGTCTGATTAGCTAGTT	M59090/L34627	Y = -3.298 x + 39.136	This study
	FirmR	CCTCTCAGGCCGGCTACTG	Y10584/FJ345661	r² = 0.9924

Primers sequences were designed using the following website: http://www.ncbi.nlm.nih.gov/blast/. PCR: Polymerase chain reaction; NCBI: National Center for Biotechnology Information.