Copyright
©2012 Baishideng Publishing Group Co.
World J Gastroenterol. May 7, 2012; 18(17): 2043-2052
Published online May 7, 2012. doi: 10.3748/wjg.v18.i17.2043
Published online May 7, 2012. doi: 10.3748/wjg.v18.i17.2043
Table 1 Primer sequences for polymerase chain reaction
Gene | Primer sequences (forward/reverse 5’-3’) | Accession No. | Location to transcription start | Product size (bp) | Annealing temperature (°C) |
SPARC methylation | GAGAGCGCGTTTTGTTTGTC | NM_003118.2 | +52 to +71 | 112 | 54 |
AACGACGTAAACGAAAATATCG | +142 to +163 | ||||
SPARC unmethylation | TTTTTTAGATTGTTTGGAGAGTG | NM_003118.2 | +36 to +58 | 132 | 59 |
AACTAACAACATAAACAAAAATATC | +143 to +167 | ||||
SPARC BS | GATAGAGATAGTTTTGGTTATGGGA | NM_003118.2 | -119 to -95 | 401 | 55 |
CCACCTTCTAAAAAACA ACAAAC | +260 to +282 | ||||
SPARC mRNA | CGCATGCGGGACTGGCTCAA | NM_003118.2 | +601 to +620 | 148 | 60 |
GCTCCACGGGG TGGTC TCCT | +729 to +748 | ||||
GAPDH mRNA | GGGCATCCTGGGCTACACTGA | NM_002046.3 | +915 to +935 | 143 | 58 |
CAAATTCGTTGTCATACCAGGAAATG | +1032 to +1057 |
Table 2 Methylation frequencies of secreted protein acidic and rich in cysteine in 60 cases
SPARC methylation status | |||
Tissue | Methylated (%) | Unmethylated (%) | P value |
Tumorous | 45 (75.00) | 15 (25.00) | < 0.001 |
Nontumorous | 7 (11.67) | 53 (88.33) |
Table 3 Protein expression frequencies in 23 pairs of samples
Protein expression | ||||
Tissue | n | Positive (%) | Negative (%) | P value |
Tumorous | 23 | 12 (52.2) | 11 (47.8) | 0.552 |
Nontumorous | 23 | 14 (60.9) | 9 (39.1) |
Table 4 Association of secreted protein acidic and rich in cysteine methylation with protein expression
Protein expression | ||||
SPARC | n | Positive (%) | Negative (%) | P value |
Methylated | 14 | 6 (42.9) | 8 (57.1) | 0.216 |
Unmethylated | 32 | 20 (62.5) | 12 (37.5) |
Table 5 Correlation between methylation status and clinicopathological data
Parameters | n | Methylated | Unmethylated | P value |
Age (yr) | 0.766 | |||
> 53 | 30 | 23 | 7 | |
≤ 53 | 30 | 22 | 8 | |
Gender | 0.835 | |||
Male | 51 | 38 | 13 | |
Female | 9 | 7 | 2 | |
Tumor size (cm) | 1.000 | |||
≤ 5 | 20 | 15 | 5 | |
> 5 | 40 | 30 | 10 | |
Virus infection | 0.661 | |||
HBV or HCV | 52 | 40 | 12 | |
Negative | 8 | 5 | 3 | |
Liver function | 1.000 | |||
Child-Pugh A | 46 | 35 | 11 | |
Child-Pugh B | 14 | 10 | 4 | |
AFP (μg/L) | 0.125 | |||
≤ 400 | 35 | 29 | 6 | |
> 400 | 23 | 15 | 8 | |
Tumor number | 0.174 | |||
Single | 35 | 24 | 11 | |
Multiple | 25 | 21 | 4 | |
Vascular invasion | 0.122 | |||
Positive | 22 | 19 | 3 | |
Negative | 38 | 26 | 12 | |
Edmondson classification | 0.019 | |||
I/II | 21 | 12 | 9 | |
III/IV | 39 | 33 | 6 |
Table 6 Survival analysis of patients with different methylation status
Gene | M/U | n | Disease free survival | Overall survival | ||||||
Estimate (mo) | Scope (mo) | Log-Rank | P value | Estimate (mo) | Scope (mo) | Log-Rank | P value | |||
SPARC | M | 37 | 15.0 | 9.6-20.4 | 2.094 | 0.148 | 28.0 | 17.8-38.2 | 4.096 | 0.043 |
U | 14 | 24.0 | 12.6-35.5 | 41.0 | 36.5-45.5 |
Table 7 Cox regression model of overall survival
Factors | Univariate analysis | Multivariate analysis | ||||
RR | 95% CI | P value | RR | 95% CI | P value | |
Methylation | ||||||
Positive | 2.672 | 0.999-7.147 | 0.044 | 3.207 | 1.290-7.975 | 0.012 |
Negative | 1 | 1 | ||||
Tumor size (cm) | ||||||
> 5 | 5.293 | 1.560-17.959 | 0.008 | 8.045 | 2.125-30.456 | 0.002 |
≤ 5 | 1 | 1 | ||||
AFP (μg/L) | ||||||
> 400 | 3.306 | 1.421-7.694 | 0.006 | 7.105 | 1.798-28.080 | 0.005 |
≤ 400 | 1 | 1 | ||||
Age (yr) | ||||||
> 53 | 0.663 | 0.279-1.576 | 0.353 | |||
≤ 53 | 1 | |||||
Gender | ||||||
Male | 1.104 | 0.373-3.266 | 0.859 | |||
Female | 1 | |||||
Tumor number | ||||||
Multiple | 3.330 | 1.440-7.704 | 0.005 | |||
Single | 1 | |||||
Vascular invasion | ||||||
Positive | 2.776 | 1.186-6.502 | 0.019 | |||
Negative | 1 | |||||
Edmondson classification | ||||||
I/II | 0.379 | 0.147-0.982 | 0.046 | |||
III/IV | 1 |
-
Citation: Zhang Y, Yang B, Du Z, Bai T, Gao YT, Wang YJ, Lou C, Wang FM, Bai Y. Aberrant methylation of
SPARC in human hepatocellular carcinoma and its clinical implication. World J Gastroenterol 2012; 18(17): 2043-2052 - URL: https://www.wjgnet.com/1007-9327/full/v18/i17/2043.htm
- DOI: https://dx.doi.org/10.3748/wjg.v18.i17.2043