Wnt5a participates in hepatic stellate cell activation observed by gene expression profile and functional assays

Table 1 Primer sequences of genes validating the microarray analysis by quantitative real-time polymerase chain reaction

Gene name	Sense primer	Antisense primer
Wnt5a	AGGGCTCCTACGAGAGTGCT	GACACCCCATGGCACTTG
Frizzled2	TCTCTGAGGACGGTTATCGCA	CAGAATCACCCACCAGATGGA
Calcium calmodulin mediated kinase IIdelta	TCGGCTCACACAGTACATGGA	CCCCGAACGATGAAAGTGAA
α-1 type I collagen	ACAGACTGGCAACCTCAAGAAG	AAGCGTGCTGTAGGTGAATCG
Connective tissue growth factor	GTTGGCGAACAAATGGCCTT	TGCCTCCCA AACCAGTCATAG
Glyceraldehydes-3-phosphate dehydrogenase	TCCTGCACCACCAACTGCTTAG	AGTGGCAGTGATGGCATGGACT

Table 2 Top 20 enriched Gene Ontology terms based on Gene Ontology classifications

Biological process	Count	Percent	Molecular function	Count	Percent	Cellular component	Count	Percent
Response to wounding	78	7.24	Cytoskeletal protein binding	73	6.78	Extracellular region part	125	11.61
Wound healing	46	4.27	Actin binding	52	4.83	Extracellular region	180	16.71
Regulation of cell growth	43	3.99	Growth factor binding	24	2.23	Extracellular matrix	69	6.41
Vasculature development	50	4.64	Glycosaminoglycan binding	24	2.23	Proteinaceous extracellular matrix	61	5.66
Actin cytoskeleton organization	42	3.90	Calcium ion binding	76	7.06	Extracellular matrix part	34	3.16
Actin filament-based process	43	3.99	Extracellular matrix structural constituent	14	1.30	Cytoskeleton	125	11.61
Blood vessel development	48	4.46	Heparin binding	19	1.76	Basement membrane	25	2.32
Cell migration	51	4.73	Polysaccharide binding	24	2.23	Extracellular space	71	6.59
Cell adhesion	72	6.69	Pattern binding	24	2.23	Cell projection	92	8.54
Biological adhesion	72	6.69	Insulin-like growth factor binding	11	1.02	Cytoskeletal part	88	8.17
Regulation of growth	55	5.11	Integrin binding	12	1.11	Cell surface	53	4.92
Regulation of cellular component size	46	4.27	Carbohydrate binding	39	3.62	Actin cytoskeleton	39	3.62
Extracellular matrix organization	27	2.51	Chemokine activity	10	0.93	Actin filament bundle	14	1.30
Regulation of cell proliferation	87	8.08	Chemokine receptor binding	10	0.93	Plasma membrane	216	20.06
Cytoskeleton organization	54	5.01	Protein complex binding	29	2.69	Collagen	12	1.11
Response to organic substance	109	10.1	Identical protein binding	57	5.29	Actomyosin	14	1.30
Response to hormone stimulus	72	6.69	Collagen binding	8	0.74	Stress fiber	13	1.21
Response to endogenous stimulus	77	7.15	Growth factor activity	20	1.86	Microtubule cytoskeleton	53	4.92
Cell motion	62	5.76	Platelet-derived growth factor binding	5	0.46	Cell leading edge	26	2.41
Blood vessel morphogenesis	38	3.52	Phospholipid binding	20	1.86	Vesicle lumen	15	1.39

Table 3 Signaling pathway related to activation of hepatic stellate cells

Terms	Count	Percent	P value	Fold enrichment	Benjamini
rno04510: Focal adhesion	51	4.73	6.34E-19	4.16	9.90E-17
rno04512: Extracellular matrix-receptor interaction	27	2.50	9.93E-13	5.30	7.75E-11
rno04810: Regulation of actin cytoskeleton	36	3.34	5.18E-08	2.74	2.69E-06
rno05200: Pathways in cancer	40	3.71	2.74E-05	2.00	0.001066
rno05414: Dilated cardiomyopathy	18	1.67	3.27E-05	3.18	0.00102
rno05410: Hypertrophic cardiomyopathy	17	1.57	5.01E-05	3.22	0.001302
rno04350: Transforming growth factor-beta signaling pathway	17	1.57	6.76E-05	3.148	0.001505
rno04540: Gap junction	15	1.39	4.27E-04	2.94	0.008302
rno04110: Cell cycle	19	1.76	7.69E-04	2.40	0.013254
rno04666: Fc gamma R-mediated phagocytosis	15	1.39	0.001011	2.71	0.015653
rno05222: Small cell lung cancer	14	1.29	0.001758	2.68	0.024645
rno04062: Chemokine signaling pathway	22	2.04	0.002121	2.04	0.027229
rno04115: p53 signaling pathway	12	1.11	0.002359	2.89	0.027945
rno05211: Renal cell carcinoma	12	1.11	0.003385	2.76	0.03708
rno04310: Wnt signaling pathway	19	1.76	0.003846	2.08	0.039281
rno04670: Leukocyte transendothelial migration	16	1.48	0.005063	2.21	0.048281
rno04010: MAPK signaling pathway	28	2.59	0.008006	1.67	0.071107
rno05219: Bladder cancer	7	0.64	0.022754	3.09	0.172201
rno04270: Vascular smooth muscle contraction	14	1.29	0.0235	1.97	0.169299
rno05212: Pancreatic cancer	10	0.92	0.027028	2.30	0.184168