Smad7 dependent expression signature highlights BMP2 and HK2 signaling in HSC transdifferentiation

Table 1 Primer used for quantitative real-time polymerase chain reaction validation of array results

Gene	Probe set ID	Forward	Reverse
CYP4B1	M29853	5'CCGAAGGCTGCAGATGTGT3'	5'TTTGGCCCATCCAGAACTAGTAG3'
mSmad7		5'GGTGCTCAAGAAACTCAAGG3'	5'CAGCCTGCAGTCCAGGCG3'
BMP2	L02678_at	5'TGCCCCCTAGTGCTTCTTAGAC3'	5'GGGAAGCAGCAACACTAGAAGAC3'
SGIII	U02983	5'CAAGCAGGACCGAGAATCAG3'	5'CGTTGGACAAGGTCAAGGTG3'
Zfp423	U92564	5'GCAGTGCTACACCTGACTCG3'	5'GTCATCCCGCATCTTCTTCTG3'
Pla2g2a	x51529	5'GCTCAATTCAGGTCCAGGG3'	5'CCACCCACACCACAATGG3'
EST189231	AA799734	5'CGGCTCACTGAGCTTGAAGTAG3'	5'ACACGACGGAGGAGCTTCTG3'
Olr1	AB005900	5'CAGAGAGAACTGAAGGAACAG3'	5'GGACCTGAAGAGTTTGCAGC3'
ID1	L23148_g_at	5'TGGACGAACAGCAGGTGAAC3'	5'TCTCCACCTTGCTCACTTTGC3'
HK2	D26393exon_s_at	5'CTCAGAGCGCCTCAAGACAAG3'	5'GATGGCACGAACCTGTAGCA3'
Slc16a3	U87627	5'CTCATCGGACCCCCATCAG3'	5'CGCCAGGATGAACACATACTTG3'
ratVEGF.1		5'TGCCAAGTGGTCCCAGGC3'	5'ATTGGACGGCAATAGCTGCG3'

Table 2 One hundred genes selected as being differentially expressed after Smad7 overexpression in hepatic stellate cells (note that some specific transcripts are detected by more than one probe set)

Official symbol	Average log2 fold	SD log2 fold	Affymetrix probe set ID	Official full name
Downregulated (n = 72)
Acta2	-0.85	0.21	X06801cds_i_at	Smooth muscle α-actin
Ak3l1	-1.20	0.42	rc_AA891949_at	Adenylate kinase 3-like 1
Akap12	-1.00	0.57	U75404UTR#1_s_at	A kinase (PRKA) anchor protein (gravin) 12
Akr1b1	-0.70	0.42	M60322_g_at	Aldo-keto reductase family 1, member B1 (aldose reductase)
Atp6v1b2	-1.10	0.14	Y12635_at	ATPase, H transporting, lysosomal V1 subunit B2
Btg1	-0.65	0.49	L26268_g_at	B-cell translocation gene 1, anti-proliferative
Clec4f	-2.40	3.39	M55532_at	C-type lectin domain family 4, member f
Cml5	-1.30	0.42	rc_AA894273_at	Camello-like 5
Cnn1	-1.30	0.57	D14437_s_at	Calponin 1
Col1a1	-1.51	0.53	M27207mRNA_s_at/rc_AI231472_s_at/U75405UTR#1_f_at/Z78279_at/Z78279_g_at	Procollagen, type 1, α 1
Cryab	-1.13	0.32	M55534mRNA_s_at/X60351cds_s_at	Crystallin, α B
Cyp1b1	-1.10	0.28	rc_AI176856_at/U09540_at/U09540_g_at	Cytochrome P450, family 1, subfamily b, polypeptide 1
Ddah1	-0.95	0.21	D86041_at	Dimethylarginine dimethylaminohydrolase 1
Dpysl2	-0.95	0.64	rc_AA875444_at	Dihydropyrimidinase-like 2
Egr2	-1.25	0.64	U78102_at	Early growth response 2
Eif4ebp1	-1.05	0.07	U05014_at	Eukaryotic translation initiation factor 4E binding protein 1
Emp1	-0.65	0.78	Z54212_at	Epithelial membrane protein 1
Eno2	-0.80	0.71	X07729exon#5_s_at	Enolase 2, γ
Ercc1	-0.75	0.49	rc_AA892791_at	Excision repair cross-complementing rodent repair deficiency, complementation group 1
EST (unknown)	-2.65	0.64	rc_AI102814_at	EST
EST (unknown)	-2.60	0.28	rc_AI230256_at	EST
EST (unknown)	-2.00	0.14	rc_AA874889_g_at	EST
EST (unknown)	-1.40	0.85	rc_AA866419_at	EST
EST (unknown)	-1.35	0.64	X62950mRNA_f_at	EST
EST (unknown)	-1.10	0.99	rc_AA859740_at	EST
EST (unknown)	-0.85	0.35	rc_AA800708_at	EST
EST (unknown)	-0.40	1.41	X62951mRNA_s_at	EST
F3	-1.85	0.92	U07619_at	Coagulation factor III
Fabp5	-0.80	0.57	S69874_s_at	Fatty acid binding protein 5, epidermal
Fkbp1a	-0.65	0.49	rc_AI228738_s_at	FK506 binding protein 1a
Fn1	-1.15	0.36	L00190cds#1_s_at/U82612cds_g_at/X05834_at	Fibronectin 1
Fntb	-1.28	0.49	rc_AI136396_at/rc_AI230914_at	Farnesyltransferase, CAAX box, β
Gabbr1	-1.25	0.92	rc_AI639395_at	γ-aminobutyric acid (GABA) B receptor 1
Gpx3	-1.10	0.14	D00680_at	Glutathione peroxidase 3
Hig1	-0.95	0.49	rc_AA891422_at	Hypoxia induced gene 1
Hk2	-3.20	0.00	D26393exon_s_at	Hexokinase 2
Id1	-2.55	0.35	L23148_g_at	Inhibitor of DNA binding 1
Id2	-2.45	0.21	rc_AI137583_at	Inhibitor of DNA binding 2
Id3	-1.85	0.13	AF000942_at/rc_AI009405_s_at	Inhibitor of DNA binding 3
Idi1	-0.70	0.57	AF003835_at	Isopentenyl-diphosphate delta isomerase
LOC686781	-1.25	0.21	rc_AA799657_at	Similar to NFκB interacting protein 1
Lox	-1.10	0.17	rc_AA875582_at/rc_AI234060_s_at/S77494_s_at	Lysyl oxidase
Lpl	-1.20	0.71	L03294_at/L03294_g_at/rc_AI237731_s_at	Lipoprotein lipase
Lrrc59	-0.65	0.64	D13623_at	Leucine rich repeat containing 59
Lum	-0.80	0.42	X84039_at	Lumican
Ncam1	-1.35	0.78	X06564_at	Neural cell adhesion molecule 1
Olr1	-2.43	0.99	AB005900_at/AB018104cds_s_at/rc_AI071531_s_at	Oxidized low density lipoprotein (lectin-like) receptor 1
P4ha1	-0.85	0.21	X78949_at	Procollagen-proline, 2-oxoglutarate 4-dioxygenase (proline 4-hydroxylase), α 1 polypeptide
Pcsk6	-1.10	0.71	rc_AI230712_at	Proprotein convertase subtilisin/kexin type 6
Pfkp	-1.25	0.54	L25387_at/L25387_g_at	Phosphofructokinase, platelet
Plaur	-1.20	0.71	X71898_at	Plasminogen activator, urokinase receptor
Plod2	-1.00	0.28	rc_AA892897_at	Procollagen lysine, 2-oxoglutarate 5-dioxygenase 2
Pmepa1	-1.55	0.07	rc_AI639058_s_at	Prostate transmembrane protein, androgen induced 1
Ptk2	-0.85	0.35	S83358_s_at	PTK2 protein tyrosine kinase 2
Rasl11a	-2.25	0.49	rc_AI169372_at	RAS-like family 11 member A
Rasl11b	-1.03	0.24	rc_AA800853_at/rc_AA800853_g_at	RAS-like family 11 member B
Rcn2	-0.90	0.57	U15734_at	Reticulocalbin 2
RGD1306841	-1.10	0.14	rc_AI639203_at	Similar to RIKEN cDNA 2410006F12
RGD1310444_predicted	-1.25	0.21	rc_AA866432_at	LOC363015 (predicted)
Rgs4	-1.45	0.64	U27767_at	Regulator of G-protein signaling 4
Sc4mol	-1.10	0.45	E12625cds_at/rc_AI172293_at	Sterol-C4-methyl oxidase-like
Schip1	-1.00	0.42	rc_AA800036_at	Schwannomin interacting protein 1
Serpine1	-1.90	0.00	M24067_at	Serine (or cysteine) peptidase inhibitor, clade E, member 1
Slc12a2	-0.80	0.99	AF051561_s_at	Solute carrier family 12, member 2
Slc16a3	-2.05	0.35	U87627_at	Solute carrier family 16 (monocarboxylic acid transporters), member 3
Slc2a1	-1.15	0.35	S68135_s_at	Solute carrier family 2 (facilitated glucose transporter), member 1
Spink8	-2.55	1.48	rc_AA799734_at	Serine peptidase inhibitor, kazal type 8
Tfrc	-0.90	0.42	M58040_at	Transferrin receptor
Tnc	-0.90	0.28	U09401_s_at	Tenascin C
Tnnt2	-1.70	0.42	M80829_at	Troponin T2, cardiac
Vegfa	-2.25	1.28	L20913_s_at/M32167_g_at/rc_AA850734_at	Vascular endothelial growth factor A
Wfdc1	-1.70	0.14	AF037272_at	WAP four-disulfide core domain 1
Up-regulated (n = 28)
Adora2a	0.85	0.35	S47609_s_at	Adenosine A2a receptor
Agtr1a	0.95	0.21	M74054_s_at/X62295cds_s_at	Angiotensin II receptor, type 1 (AT1A)
Bmp2	2.83	1.31	L02678_at/rc_AA997410_s_at	Bone morphogenetic protein 2
Col3a1	0.90	0.42	M21354_s_at/X70369_s_at/	Procollagen, type III, α 1
Cxcl10	1.05	0.21	U17035_s_at	Chemokine (C-X-C motif) ligand 10
Cyp2e1	1.00	0.14	M20131cds_s_at	Cytochrome P450, family 2, subfamily e, polypeptide 1
Cyp4b1	3.25	0.49	M29853_at	Cytochrome P450, family 4, subfamily b, polypeptide 1
Ednrb	0.70	0.42	rc_AA818970_s_at	Endothelin receptor type B
Ephx1	1.15	0.21	M26125_at	Epoxide hydrolase 1, microsomal
EST (unknown)	0.80	0.28	rc_AA874873_g_at	EST
EST (unknown)	0.90	0.28	rc_AI177256_at	EST
Glul	0.90	0.23	M91652complete_seq_at/rc_AA852004_s_at	Glutamate-ammonia ligase (glutamine synthase)
Hgf	1.03	0.05	E03190cds_s_at/X54400_r_at	Hepatocyte growth factor
Hsd11b1	0.95	0.49	rc_AI105448_at	Hydroxysteroid 11-β dehydrogenase 1
Igfbp3	1.15	0.30	M31837_at	Insulin-like growth factor binding protein 3
Kif4	1.05	0.07	rc_AA859926_at	Kinesin family member 4
Lhx2	0.95	0.21	L06804_at	LIM homeobox protein 2
Notch1	0.80	0.42	X57405_g_at	Notch gene homolog 1 (Drosophila)
Nr2f1	0.95	0.21	U10995_g_at	Nuclear receptor subfamily 2, group F, member 1
Pdcd4	1.00	0.14	rc_AI172247_at	Programmed cell death 4
Pdgfra	1.10	0.28	rc_AI232379_at	Platelet derived growth factor receptor, α polypeptide
Pla2g2a	3.60	0.00	X51529_at	Phospholipase A2, group IIA (platelets, synovial fluid)
Ptn	2.10	0.57	rc_AI102795_at	Pleiotrophin
Scg3	2.70	0.85	U02983	Secretogranin III
Serping1	0.85	0.21	rc_AA800318_at	Serine (or cysteine) peptidase inhibitor, clade G, member 1
Smad7	5.35	1.20	AF042499_at	MAD homolog 7 (Drosophila)
Sod3	1.05	0.07	Z24721_at	superoxide dismutase 3, extracellular
Zfp423	1.85	1.47	U92564_at/U92564_g_at	Zinc finger protein 423

The average change in expression after Smad7 overexpression is given as log2 fold. SD: Square root of the variance; NFκB: Nuclear factor κB.

Table 3 Comparison of gene regulation in activated hepatic stellate cells in vivo (De Minicis et al[13])

Gene symbol	Smad7 overexpressing HSCs	In vivo activated untransformed HSCs
Acta2	↓	↑
BMP21	↑	↓
Cnn1	↓	↑
Col1a1	↓	↑
Col3a1	↑	↑
Cryab	↓	↓
Cyp1b1	↓	↑
Ddah1	↓	↑
Ednrb	↑	↑2
Eno2	↓	↓
Ephx1	↑	↑2
Fn1	↓	↑
Gabbr1	↓	↓
Hgf	↑	↑2
Hk21	↓	↑
Hsd11b1	↑	↑2
Id1	↓	↓
Igfbp3	↑	↑2
Kif4	↑	↑
Lox	↓	↑
Lpl	↓	↑2
Lum	↓	↑
Ncam1	↓	↑
P4ha1	↓	↑
Pdgfra	↑	↓
Pfkp	↓	↑
Plod2	↓	↑
Rasl11b	↓	↑
Serping1	↑	↑
Slc16a3	↓	↑
Slc2a1	↓	↑
Sod3	↑	↑
Tmepai_predicted	↓	↓2
Tnc	↓	↓2
Tnnt2	↓	↑
VEGFa1	↓	↑ (VEGFc)1
Wfdc1	↓	↑2

Gene expression profiles during hepatic stellate cell activation in culture and in vivo (Gastroenterology 2007; 132: 1937-1946[13]) and Smad7 overexpressing hepatic stellate cells (HSCs) (our study).

¹Genes regulated the strongest in our study are marked;

²The regulation of in vivo activated HSCs which is different compared to culture activated HSCs in De Minicis study. In total 37 genes overlap in both studies, 22 of those (60%) are oppositely regulated indicating participation of transforming growth factor-β/Smad7 on the regulation of those genes in vivo.

Table 4 Comparison of gene regulation according to quantitative real-time polymerase chain reaction analysis and array analysis

Gene	Probe set ID	Array	RT-PCR analysis
Cyp4B1	M29853_at	Up	Up
Smad7	AF042499_at	Up	Up
BMP2	L02678_at/rc_AA997410_s_at	Up	Up
SGIII	U02983_at	Up	Up
Zfp423	U92564_at/U92564_g_at	Up	Up
Pla2g2a	x51529_at	Up	Up
EST189231	AA799734_at	Down	Down
Olr1	AB005900_at/ AB018104cds_s_at/ rc_AI071531_s_at	Down	Down
ID1	L23148_g_at	Down	Down
HK2	D26393exon_s_at	Down	3 d down/7 d up
Slc16a3	U87627_at	Down	3 d down/7 d up
VEGFa/ratVEGF.1 in RT-PCR	L20913_s_at/M32167_g_at	Down	3 d down/7 d up

Different results in array and quantitative real-time polymerase chain reaction (RT-PCR) analysis are marked bold.