Loss of chromosome 9p21 and decreased p16 expression correlate with malignant gastrointestinal stromal tumor

Table 1 Primer sequences and product size used in polymerase chain reaction for each primer on chromosome 9p21

Marker	Forward primer (5'→3')	Reverse primer (5'→3')	PCR product size (bp)
D9S1751	TTGTTGATTCTGCCTTCAAAGTCTTTTAAC	CGTTAAGTCCTCTATTACACAGAG	150-170
D9S1846	AATGGCTGGTTCTAGGACTG	AAACTGGTCTGGTGTTTGC	183-197
D9S942	GCAAGATTCCAAACAGTA	CTCATCCTGCGGAAACCATT	100-130
D9S1748	CACCTCAGAAGTCAGTGAGT	GTGCTTGAAATACACCTTTCC	130-150

PCR: Polymerase chain reaction.

Table 2 Clinicopathological data and p16 expression in gastrointestinal stromal tumors

Case	Sex	Age (yr)	Risk1	Site	OS (mo)	1751	1846	942	1748	p16 expression
1	Male	41	Low	SI	Alive (50)	2	2	2	3	N
2	Male	73	Low	S	Alive (47)	3	2	4	4	N
3	Male	33	Very low	SI	Alive (21)	4	3	2	4	N
4	Female	66	Low	S	Alive (18)	4	4	3	3	P
5	Female	71	Low	SI	Alive (17)	4	4	4	4	P
6	Male	46	Low	SI	Alive (15)	4	4	4	3	P
7	Female	59	Low	SI	Alive (5)	3	4	4	3	P
8	Female	45	Low	SI	Alive (13)	4	3	3	4	P
9	Male	65	Low	SI	Alive (11)	3	3	3	4	P
10	Male	66	Low	S	Alive (11)	4	4	4	4	P
11	Male	55	Low	S	Alive (5)	3	2	2	4	N
12	Male	72	Low	SI	Alive (102)	2	3	4	2	P
13	Female	54	Low	S	Alive (50)	3	3	3	3	P
14	Male	56	Low	S	NA	4	4	4	4	P
15	Female	60	Low	S	NA	3	3	3	3	P
16	Male	70	Very low	S	Alive (45)	3	3	4	4	P
17	Female	75	Low	S	Alive (18)	3	3	4	3	P
18	Male	70	Intermediate	S	Alive (100)	4	2	2	3	N
19	Female	50	Intermediate	SI	Alive (81)	4	4	4	4	P
20	Female	70	Intermediate	S	Alive (88)	4	4	2	2	N
21	Male	72	Intermediate	SI	Alive (78)	2	4	4	3	P
22	Male	56	Intermediate	SI	Dead (60)	3	2	2	3	P
23	Male	47	Intermediate	S	Alive (53)	2	3	4	4	P
24	Male	50	Intermediate	M	Dead (27)	3	3	4	4	P
25	Female	73	Intermediate	S	Alive (21)	3	2	2	4	N
26	Male	79	Intermediate	S	Alive (16)	4	3	4	4	P
27	Male	63	Intermediate	S	Alive (12)	3	4	4	4	P
28	Male	68	Intermediate	S	Alive (12)	3	2	4	4	P
29	Female	56	Intermediate	S	Alive (11)	3	4	4	3	P
30	Female	57	Intermediate	SI	Alive (9)	4	4	3	4	P
31	Male	59	Intermediate	S	Alive (35)	3	4	3	2	N
32	Female	29	High	SI	Dead (38)	3	4	4	2	N
33	Female	77	High	S	Dead (35)	4	4	2	4	N
34	Male	64	High	M	Alive (71)	2	4	2	3	N
35	Male	47	High	S	Dead (56)	2	4	2	4	N
36	Female	50	High	S	Alive (62)	3	2	4	2	N
37	Female	36	High	SI	Dead (11)	2	4	4	4	N
38	Female	62	High	S	Alive (55)	4	2	3	2	P
39	Male	60	High	S	Alive (54)	3	4	3	4	P
40	Female	61	High	S	Alive (63)	2	3	3	4	N
41	Male	50	High	S	Alive (51)	3	3	3	2	P
42	Male	75	High	S	Dead (18)	2	4	2	3	N
43	Male	58	High	S	Alive (46)	3	3	3	4	P
44	Male	52	High	S	Alive (31)	4	3	2	3	N
45	Male	56	High	SI	Alive (31)	3	2	4	3	P
46	Male	57	High	SI	Alive (19)	2	3	2	4	P
47	Male	67	High	M	Alive (18)	3	2	3	2	P
48	Female	47	High	SI	Dead (5)	4	3	2	3	N
49	Female	80	High	SI	Alive (12)	3	3	2	4	N
50	Female	48	High	S	Alive (12)	3	3	2	3	P
51	Male	44	High	S	Dead (86)	4	2	4	3	N

¹According to the consensus approach by Fletcher et al[4];

²Indicates loss of heterozygosity (LOH);

³Uninformative (homozygosity);

⁴Indicates no LOH. S: Stomach; SI: Small intestine; M: Mesentery; NA: Not available; OS: Overall survival; N: Negative expression; P: Positive expression.

Table 3 Results of loss of heterozygosity analyzed with four microsatellite markers in 51 gastrointestinal stromal tumors

Marker	LOH (n)	Heterozygosity (n)	Frequency of LOH (%)
D9S1751	10	17	37.0
D9S1846	12	20	37.5
D9S942	16	22	42.1
D9S1748	8	25	24.2

LOH: Loss of heterozygosity.

Table 4 Rresults of loss of heterozygosity in 51 gastrointestinal stromal tumors according to Fletcher’s classification

Risk classification	1751			1846			9421			1748
	LOH (n)	Hetero-zygosity (n)	Rate (%)	LOH (n)	Hetero-zygosity (n)	Rate (%)	LOH (n)	Hetero-zygosity (n)	Rate (%)	LOH (n)	Hetero-zygosity (n)	Rate (%)
Very low and low	2	7	22.2	3	6	33.3	3	9	25.0	1	9	10.0
Intermediate	2	5	28.6	4	7	36.4	4	8	33.3	2	8	20.0
High	6	5	54.5	5	7	41.7	9	5	64.3	5	8	38.5

¹There was a higher loss of heterozygosity (LOH) frequency of D9S942 in the high-risk than in non-high-risk tumors (P < 0.05, χ² = 4.47). There were no substantial differences in LOH frequencies among three groups of 4 markers.

Table 5 Statistical analysis of p16 expression and clinicopathologic factors

	p16 (-)	p16 (+)	P value (χ2)
Sex
Male	12	18
Female	9	12	0.838 (0.042)
Age (yr)
< 50	5	4
≥ 50	16	26	0.334 (0.933)
Size (cm)
< 5	4	13
≥ 5	17	17	0.070 (3.279)
Mitotic index
≤ 5/50 HPF	8	21
> 5/50 HPF	13	9	0.024 (5.126)
Risk
Very low and low	4	13
High	12	8	0.045 (4.98)
Site
Stomach	13	17
Intestine	7	11
Other	1	2	0.917 (0.173)

HPF: High-power fields.