ApoB-100, ApoE and CYP7A1 gene polymorphisms in Mexican patients with cholesterol gallstone disease

Table 1 Conditions and products of polymerase chain reaction followed by restriction fragment length polymorphism

Gene	Primers	Tm (°C)	RE	bp	Alleles
ApoB	Forward: GGAGACTATTCAGAAGCTAA	55	XbaI	710	X-: 710 bp
	Reverse: GAAGAGCCTGAAGACTGACT				X+: 433 and 277 bp
ApoE	Forward: ACAGAATTCGCCCCGGCCTGGTACAC	60	HhaI	252	E2: 91 and 84 bp
	Reverse: TAAGCTTGGCACGGCTGTCCAAGGA				E3: 91, 48 and 36 pb
					E4: 72, 48 and 36 bp
CYP7A1	Forward: CAGAGCATGGACAGGGAGCAG	55	BsaI	948	A: 581, 367 bp
	Reverse: GCAACTCCTCATGGCTGAGGTT				C: 542, 367 and 39 bp

Forward and reverse primers in 5’ to 3’ directions. Tm: Annealing temperature; RE: Restriction enzyme.

Table 2 Clinical characteristics in control subjects and patients with gallstones (mean ± SD)

Variable	Patients (n = 101)	Controls (n = 101)	P
Sex (F/M)	86.10%/13.90%	86.10%/13.90%	1.000
Age (yr)	51.93 ± 11.23	51.74 ± 10.99	0.904
Body mass index (kg/m2)	29.03 ± 4.19	27.63 ± 4.42	0.024
Serum glucose (mg/dL)	120.24 ± 44.20	100.30 ± 34.64	0.000
Lipids (mg/dL)	622.00 ± 149.77	688.60 ± 160.68	0.003
Cholesterol (mg/dL)	187.32 ± 45.10	208.21 ± 43.14	0.001
LDL cholesterol (mg/dL)	118.58 ± 41.64	130.94 ± 33.80	0.022
Triglycerides (mg/dL)	119.76 ± 87.05	144.45 ± 72.22	0.029
HDL cholesterol (mg/dL)	43.27 ± 13.26	46.56 ± 14.01	0.089
Cholesterol in stones (% by weight)	99.23 ± 2.50

LDL: Low density lipoprotein; HDL: High density lipoprotein.

Table 3 Allelic (af) and genotypic (gf) frequencies of ApoB-100, ApoE and CYP7A1 polymorphisms in patients with gallstones and controls

Polymorphism	Patients (n = 101)		Controls (n = 101)		P value	OR	95% CI
ApoB-100 XbaI
Alleles	n	af	n	af
X-	133	65.84%	118	58.42%	0.124	1.37	0.92-2.05
X+	69	34.16%	84	41.58%	0.124	0.73	0.49-1.09
Genotypes	n	gf	n	gf
X-X-	41	40.59%	34	33.66%	0.308	1.35	0.76-2.39
X+X-	51	50.50%	50	49.50%	0.888	1.04	0.60-1.81
X+X+	9	8.91%	17	16.83%	0.093	0.48	0.20-1.14
ApoE HhaI
Alleles	n	af	n	af
E2	9	4.46%	12	5.94%	0.501	0.74	0.30-1.79
E3	173	85.64%	158	78.22%	0.052	1.66	0.99-2.78
E4	20	9.90%	32	15.84%	0.075	0.58	0.32-1.06
Genotypes	n	gf	n	gf
E2E2	0	0.00%	1	0.99%	NC	NC	NC
E3E3	74	73.27%	64	63.37%	0.130	1.58	0.87-2.88
E4E4	1	0.99%	2	1.98%	0.561	0.50	0.04-5.55
E2E3	8	7.92%	6	5.94%	0.580	1.36	0.45-4.08
E2E4	1	0.99%	4	3.96%	0.174	0.24	0.03-2.21
E3E4	17	16.83%	24	23.76%	0.221	0.65	0.32-1.30
CYP7A1 BsaI
Alleles	n	af	n	af
A	150	74.26%	146	72.28%	0.653	1.11	0.71-1.72
C	52	25.74%	56	27.72%	0.653	0.90	0.58-1.40
Genotypes	n	gf	n	gf
AA	59	58.42%	56	55.45%	0.670	1.13	0.65-1.97
CA	32	31.68%	34	33.66%	0.764	0.91	0.51-1.65
CC	10	9.90%	11	10.89%	0.818	0.90	0.36-2.22

OR: Odds ratio; 95%CI: 95% confidence intervals; NC: Not calculated.