Effects of blueberry on hepatic fibrosis and transcription factor Nrf2 in rats

doi:10.3748/wjg.v16.i21.2657

Advanced Search

BPG is committed to discovery and dissemination of knowledge

Home / Archive / Volume 16, Issue 21

This Article

Citation of this article

Corresponding Author of This Article

Article-Type of This Article

Open-Access Policy of This Article

Times Cited Counts in Google of This Article

Number of Hits and Downloads for This Article

Total Article Views (5614)

All Articles published online

The chart showing PDF series, HTML series, Figures (1-4) series, Tables (1-4) series.

Item

Count

PDF

522

HTML

4760

Figures (1-4)

188

Tables (1-4)

144

Sum=5614

Jun 7, 2010 (publication date) through May 4, 2024

Times Cited of This Article

Times Cited (47)

Journal Information of This Article

Publication Name

World Journal of Gastroenterology

ISSN

1007-9327

Publisher of This Article

Baishideng Publishing Group Inc, 7041 Koll Center Parkway, Suite 160, Pleasanton, CA 94566, USA

Original Article

World J Gastroenterol. Jun 7, 2010; 16(21): 2657-2663
Published online Jun 7, 2010. doi: 10.3748/wjg.v16.i21.2657

Table 1 Primer sequences for real-time RT-PCR analyses

Genes	GenBank
Genes	Number	Forward	Reverse
β-actin	V01217	TCCTCCTGAGCGCAAGTACTCT	GCTCAGTAACAGTCCGCCTAGAA
Nrf2	NM_057152	CCATGCCTTCTTCCACGAA	AGGGCCCATGGATTTCAGTT
Nqo1	NM_017000	CCAATCCTCCACCCACTTGT	GTCCCTCAGCCATTGTTTGAG

RT-PCR: Reverse transcriptase-polymerase chain reaction.

Table 2 Liver index, serum HA, ALT, and SOD, MDA, GST of liver homogenate in different groups (mean ± SD)

Group	n	Liver index (relative liver weight)	HA (ng/mL)	ALT (U/L)	SOD (μ/mg)	MDA (nmol/mg)	GST (μ/mg)
A	8	0.03 ± 0.000	351.75 ± 125.16	57.25 ± 6.88	1.76 ± 0.34	0.206 ± 0.052	5.95 ± 1.97
B	8	0.054 ± 0.009^a	828.50 ± 237.83^a	203.25 ± 31.62^a	1.08 ± 0.19^a	0.335 ± 0.056^a	7.30 ± 1.26^a
C	9	0.038 ± 0.008^c	502.33 ± 110.57^c	149.44 ± 16.51^a^c	1.36 ± 0.09^c	0.294 ± 0.026^a^c	7.37 ± 0.87^a
D	8	0.036 ± 0.007^c	524.25 ± 255.42^c	136.88 ± 10.07^a^c	1.42 ± 0.13^c	0.285 ± 0.025^a^c	7.35 ± 0.88^a
E	8	0.036 ± 0.005^c	499.25 ± 198.10^c	127.38 ± 11.03^a^c	1.50 ± 0.15^c	0.284 ± 0.028^a^c	7.81 ± 1.16^a

^aP < 0.05 vs group A;

^cP < 0.05 vs group B. HA: Hyaluronic acid; ALT: Alanine aminotransferase; SOD: Superoxide dismutase; MDA: Malondialdehyde; GST: Glutathione-S-transferase.

Table 3 Degree of hepatic fibrosis in each group of rats

Group	n	Degree of hepatic fibrosis							Mean rank
Group	n	0	1	2	3	4	5	6	Mean rank
A	8	5	3	0	0	0	0	0	4.5
B	8	0	0	0	0	1	6	1	34.25^a
C	9	0	0	3	2	2	2	0	23.00^a^c
D	8	0	0	4	1	1	1	1	22.38^a^c
E	8	0	0	4	1	2	1	0	20.63^a^c

^aP < 0.05 vs group A;

^cP < 0.05 vs group B.

Table 4 Expression of Nrf2 and Nqo1 in each group (mean ± SD)

Group	n	Relative amount of mRNA		Protein expression (%)		Protein level
Group	n	Nrf2	Nqo1	Nrf2	Nqo1	Nrf2	Nqo1
A	8	46.86 ± 6.49	13.38 ± 4.37	57.50 ± 26.14	15.25 ± 3.62	0.21 ± 0.03	0.06 ± 0.03
B	8	254.88 ± 55.96^a	68.38 ± 12.61^a	78.75 ± 15.29^a	42.50 ± 16.26^a	0.30 ± 0.06^a	0.16 ± 0.02^a
C	9	333.44 ± 90.53^a	72.78 ± 15.94^a	85.11 ± 13.65^a	54.44 ± 15.09^a	0.34 ± 0.08^a	0.18 ± 0.03^a
D	8	277.00 ± 67.38^a	70.63 ± 20.17^a	80.00 ± 21.38^a	50.63 ± 18.98^a	0.33 ± 0.09^a	0.17 ± 0.04^a
E	8	345.00 ± 72.60^a	77.88 ± 27.50^a	87.25 ± 14.16^a	58.13 ± 15.80^a	0.35 ± 0.09^a	0.18 ± 0.02^a

^aP < 0.05 vs group A.

Citation: Wang YP, Cheng ML, Zhang BF, Mu M, Wu J. Effects of blueberry on hepatic fibrosis and transcription factor Nrf2 in rats. World J Gastroenterol 2010; 16(21): 2657-2663
URL: https://www.wjgnet.com/1007-9327/full/v16/i21/2657.htm
DOI: https://dx.doi.org/10.3748/wjg.v16.i21.2657