Effects of Wei Chang An on expression of multiple genes in human gastric cancer grafted onto nude mice

Table 1 Xenograft tumor weight in nude mice after different treatments

Group	Test 1				Test 2				Test 3
	Number Begin/End	Tumor weight (g)	P value	Inhibition rate (%)	Number Begin/End	Tumor weight (g)	P value	Inhibition rate (%)	Number Begin/End	Tumor weight (g)	P value	Inhibition rate (%)
WCA	8/8	0.99 ± 0.76	0.0117a	48.7	8/72	1.02 ± 0.16	0.0045b	37.91	8/8	0.88 ± 0.47	0.0072b	46.35
5-FU	10/91	0.77 ± 0.48	0.0002b	60.1	7/7	0.97 ± 0.34	0.0056b	41.29	7/7	0.98 ± 0.46	0.0167a	39.74
Control	8/8	1.93 ± 0.58			8/8	1.65 ± 0.46			9/9	1.63 ± 0.52

Data are expressed in mean ± SD.

^aP < 0.05 vs control group;

^bP < 0.01 vs control group.

¹Died of toxicity of 5-FU;

²Died of the operation of gastric perfusion.

Table 2 WCA-induced effects on gastric cancer cell SGC-7901

Group	n	PCNA						TUNEL		Cleaved caspase-3 (Asp 175) (%)
		Positive rate (%)	P value	Intense positive rate (%)	P value	Total positive rate (%)	P value	Apoptotic index (%)	P value	Positive rate (%)	P value
WCA	8	35.73 ± 6.01	0.0005b	3.39 ± 1.48	0.0155a	39.03 ± 7.37	0.0009b	9.72 ± 4.51	0.0007b	5.20 ± 2.26	0.0367a
5-FU	9	37.86 ± 16.50	0.0325a	5.62 ± 4.21	0.1972	43.48 ± 19.77	0.0406a	5.74 ± 1.75	0.0007b	4.73 ± 1.76	0.0451a
Control	8	53.48 ± 9.34		8.78 ± 5.43		62.26 ± 13.80		2.45 ± 1.37		2.82 ± 1.84

Data are expressed in mean ± SD.

^aP < 0.05 vs control group;

^bP < 0.01 vs control group.

Table 3 Quantification of gene expression by real-time quantitative PCR assay

Gene name	UniGene cluster	Primer sequences (5’-3’)		Combining sites (bp)	Amplifiers (bp)	WCA (120 mg/mL) vs NS control
						ΔΔCT (n)	2-ΔΔCT
stat3	Hs.421342	forward	CCTGGAGCAGCTCCATCAG	254	58	2.65 (4)	0.16 (0.11-0.24)
		reverse	AAACTGCCGCAGCTCCATT	311
RIPX	Hs.7927	forward	GAGTGCCTTTAAGCTGCAGAGTT	6	69	2.50 (5)	0.18 (0.13-0.23)
		reverse	TCCAAGCGACTGTTTAGTTCACTT	74
ROD1	Hs.269988	forward	AACTCCTCTCTGTAAAGCATTTTGC	525	64	2.09 (4)	0.23 (0.12-0.23)
		reverse	TGCACTGGGTCTTCTTTCAGAA	588
bcl-2	Hs.12677	forward	TGTTGGCCGGATCACCAT	2557	60	3.27 (5)	0.10 (0.06-0.17)
		reverse	TCCCCAATGATCAGGTCCTTT	2616

Table 4 Xenograft gastric cancer cell SGC-7901 P-Stat3 and Bcl-2 expression after different treatments

Group	n	P-Stat3						Bcl-2
		Positive rate (%)	P value	Intense positive rate (%)	P value	Total positive rate (%)	P value	Positive rate (%)	P value
WCA	8	35.93 ± 12.67	0.0024b	3.64 ± 1.72	0.0023b	39.57 ± 13.31	0.0002b	1.62 ± 0.82	0.0006b
5-FU	9	36.95 ± 27.21	0.0732	4.38 ± 3.62	0.0050b	41.33 ± 30.22	0.0243a	7.72 ± 5.31	0.9364
Control	8	56.49 ± 9.34		13.16 ± 7.06		69.65 ± 10.80		7.53 ± 3.73

Data are expressed in mean ± SD.

^aP < 0.05 vs control group;

^bP < 0.01 vs control group.