Polymorphisms of microsomal triglyceride transfer protein in different hepatitis B virus-infected patients

doi:10.3748/wjg.14.5454

Advanced Search

BPG is committed to discovery and dissemination of knowledge

Home / Archive / Volume 14, Issue 35

This Article

Citation of this article

Corresponding Author of This Article

Article-Type of This Article

Open-Access Policy of This Article

Times Cited Counts in Google of This Article

Number of Hits and Downloads for This Article

Total Article Views (2372)

All Articles published online

The chart showing PDF series, HTML series, Tables (1-4) series.

Item

Count

PDF

248

HTML

1979

Tables (1-4)

145

Sum=2372

Sep 21, 2008 (publication date) through May 7, 2024

Times Cited of This Article

Times Cited (5)

Journal Information of This Article

Publication Name

World Journal of Gastroenterology

ISSN

1007-9327

Publisher of This Article

Baishideng Publishing Group Inc, 7041 Koll Center Parkway, Suite 160, Pleasanton, CA 94566, USA

Rapid Communication

World J Gastroenterol. Sep 21, 2008; 14(35): 5454-5460
Published online Sep 21, 2008. doi: 10.3748/wjg.14.5454

Table 1 Positions of analyzed SNP and primers used in this study

Genes (Ref.)	SNP	Primers	Sequences (5’-3’)
MTP H297Q	C/G	-1	CAGGTCTTCCAGAGCCAC
rs#2306985[23]		-2	CAGGTCTTCCAGAGCCAG
		-cp	ATTTGTCTGCACTTACAGAAGGA
MTP-493[20]	G/T	-1	ATTTAAACTGTTAATTCATACCACA
		-2	TTTAAACTGTTAATTCATACCACC
		-cp	CTTTAACATTATTTTGAAGTGATTGG

Table 2 General characteristics of 632 subjects

	Self-limited HBV infection (n = 316)	Chronic hepatitis B (n = 316)
	Self-limited HBV infection (n = 316)	With family history (n = 121)	No family history (n = 195)
Male	215	80 (25.3%)	135 (42.7%)
Female	105	41 (13.0%)	60 (19.0%)
Age (yr)	38.28 ± 11.44	36.93 ± 12.28	39.12 ± 10.84
Age range (yr)	9-75	9-69	16-75
ALT level (× ULN)	Normal	3.62 ± 3.48	3.12 ± 2.62
HBV-DNA level (Log)	Undetectable	5.45 ± 2.34

Table 3 Genotype distributions of MTP H297Q and MTP-493G/T n (%)

SNP	Genotype	Self-limited HBV infection (n = 316)	Chronic hepatitis B total (n = 316)	Chronic hepatitis B without family history (n = 195)	χ²test
					SLHBV vs CHB total		SLHBV vs CHB no FH
					Value	P	Value	P
MTP H297Q	CC	33 (10.4)	33 (10.4)	20 (10.3)	0.452	0.798	2.588	0.274
	CG	148 (46.8)	140 (44.3)	78 (40.0)
	GG	135 (42.8)	143 (45.3)	97 (49.7)
MTP-493G/T	GG	232 (73.4)	256 (81.0)	163 (83.6)	8.543	0.015	7.199	0.019¹
	GT	80 (25.3)	52 (16.5)	30 (15.4)
	TT	4 (1.3)	8 (2.5)	2 (1.0)

¹Fisher's exact test (2-Tail). SLHBV: Self-limited HBV infection group; CHB total: Chronic hepatitis B total group; CHB no FH: Chronic hepatitis B without chronic hepatitis B family history group.

Table 4 Allele Distributions of MTP H297Q and MTP-493G/T n (%)

SNP	Allele	Self-Limited HBV infection (n = 632)	Chronic hepatitis B total (n = 632)	Chronic hepatitis B without family history (n = 390)	χ²test and Mantel-Haenszel logit
					SLHBV vs CHB total			SLHBV vs CHB no FH
					P	OR	95% CI	P	OR	95% CI
MTP H297Q	C	214 (33.9)	206 (32.6)	118 (30.3)	0.52	0.903	0.659-1.236	0.232	1.18	0.899-1.549
	G	418 (66.1)	426 (67.4)	272 (69.7)
MTP-493G/T	G	544 (86.1)	564 (89.2)	356 (91.3)	0.023	0.645	0.442-0.940	0.013	0.59	0.389-0.897
	T	88 (13.9)	68 (10.8)	34 (8.7)

SLHBV: Self-limited HBV infection group; CHB total: Chronic hepatitis B total group; CHB no FH: Chronic hepatitis B without chronic hepatitis B family history group.

Citation: Yang ZT, Zhang XX, Kong XF, Zhang DH, Zhang SY, Jiang JH, Gong QM, Jin GD, Lu ZM. Polymorphisms of microsomal triglyceride transfer protein in different hepatitis B virus-infected patients. World J Gastroenterol 2008; 14(35): 5454-5460
URL: https://www.wjgnet.com/1007-9327/full/v14/i35/5454.htm
DOI: https://dx.doi.org/10.3748/wjg.14.5454