Detection of RASSF1A promoter hypermethylation in serum from gastric and colorectal adenocarcinoma patients

Table 1 Clinicopathologic characteristics of patients with gastric and colorectal adenocarcinoma

Characteristics		Patients (n)
		Gastric cancer	Colorectal cancer
Sex	Male	29	24
	Female	18	21
Age (yr)	≤ 60	21	31
	> 60	26	14
Differentiation grade	G1/Broders’ I	2	4
	G2/Broders’ II	23	34
	G3/Broders’ III & IV	22	7
Stage	TNM I/Duke’s A	4	5
	TNM II/Duke’s B	15	16
	TNM III/Duke’s C	16	14
	TNM IV/Duke’s D	12	10

Table 2 Sequences of the primers used in MSP

Primer	Sequence (5’-3’)	Amplicon location1	Annealing temperature	Product size (bp)
MF	GGGTTTTGCGAGAGCGCG	17 882-18 050	64°C	169
MR	GCTAACAAACGCGAACCG
UF	GGTTTTGTGAGAGTGTGTTTAG	17 883-18 051	59°C	169
UR	CACTAACAAACACAAACCAAAC

¹GenBank accession number of RASSF1A is AC002481. F: Forward; R: Reverse; M: Methylated; U: Unmethylated.

Table 3 Correlation between serum RASSF1A gene promoter methylation status and clinicopathologic parameters in gastric and colorectal adenocarcinoma patients

Clinicopathologic parameters		Gastric cancer			Colorectal cancer
		RASSF1A promoter status		P value	RASSF1A promoter status		P value
		M	U		M	U
Sex	Male	9	20	0.58071	7	17	0.96491
	Female	7	11		6	15
Age (yr)	≤ 60	8	13	0.59821	8	23	0.50242
	> 60	8	18		5	9
Differentiation grade	G1/Broders’ I	0	2	0.22801	1	3	0.98301
	G2/Broders’ II	6	17		10	24
	G3/Broders’ III & IV	10	12		2	5
Surgical resection	Yes	7	20	0.22031	5	10	0.73252
	No	9	11		8	22
Distant metastasis	Yes	7	5	0.07462	5	5	0.12372
	No	9	26		8	27
Serum CEA	Elevated	7	7	0.23652	6	7	0.12322
	Normal	3	10		3	14

¹Chi-square test;

²Fisher’s exact test. CEA: Carcinoembryonic antigen; M: Methylated; U: Unmethylated.