Hepatitis C virus core proteins derived from different quasispecies of genotype 1b inhibit the growth of Chang liver cells

Table 1 Primers of different quasispecies core proteins of HCV genotype 1b

	Primer up (location)	Primer down (location)
T: 1-172	CGCGCTAGCATGAGGCACGAATCC (1-14)	CCGGAATTCGCAACCGGGCAG (505-516)
NT: 1-172	CGCGCTAGCATGAGCACGAATCC (1-14)	CCGGAATTCGGCAACCGGGCAGATTC (505-516)
C191: 1-172	CGCGCTAGCATGAGCACAAATCC (1-14)	CCGGAATTCGGCAACCGGGCAAATTC (505-516)

GCTAGC, NheI site; GAATTC, EcoRI site. Primer designed according to the sequence of different core protein genes.

Table 2 Core proteins of different quasispecies of HCV genotype 1b inhibited Chang liver cell cycle by impairing G1 to S transition at 24 h after transfection

	G0/G1 phase	S phase	G2/M phase
T	67.53 ± 5.47a	17.23 ± 4.21a	15.25 ± 1.96
NT	65.49 ± 5.98a	18.56 ± 2.49a	15.95 ± 2.59
C191	66.72 ± 6.82a	17.89 ± 2.54a	15.38 ± 2.16
pEGFP-N1	59.76 ± 5.33	24.33 ± 3.16	15.93 ± 1.42

^aP < 0.05 vs pEGFP-N1.

Table 3 Core proteins of different quasispecies of HCV genotype 1b inhibited Chang liver cell cycle by impairing G1 to S transition at 48 h after transfection

	G0/G1 phase	S phase	G2/M phase
T	68.23 ± 6.54a	15.30 ± 3.12a	16.46 ± 2.57
NT	66.14 ± 5.33a	16.38 ± 2.21a	17.47 ± 3.74
C191	66.41 ± 3.02a	15.92 ± 2.93a	16.99 ± 2.43
pEGFP-N1	58.72 ± 2.23	25.69 ± 2.41	15.62 ± 1.28

^aP < 0.05 vs pEGFP-N1.

Table 4 Core proteins of different quasispecies of HCV genotype 1b inhibited Chang liver cell cycle by impairing G1 to S transition at 72 h after transfection

	G0/G1 phase	S phase	G2/M phase
T	68.45 ± 4.98a	14.79 ± 3.76a	16.75 ± 3.21
NT	67.21 ± 5.47a	16.17 ± 2.55a	16.63 ± 2.95
C191	66.77 ± 4.32a	16.38 ± 2.11a	16.86 ± 2.19
pEGFP-N1	56.97 ± 3.29	27.48 ± 3.37	15.54 ± 1.93

^aP < 0.05 vs pEGFP-N1.