Probiotic bacteria change Escherichia coli-induced gene expression in cultured colonocytes: Implications in intestinal pathophysiology

Table 1 Common genes induced by bacterial treatment (Seventeen genes were influenced by both E. coli and L. plantarum and four genes by both E. coli and combination treatment)

Nr.	Gene symbol	Gene ID NCBI	Gene name	Location	Function	Relative fold modification
						L.p.	E.c.	Mix
1	GPR34	2857	G protein-coupled receptor 34	Integral to plasma membrane	G-protein coupled receptor activity	2.43	3.03	-0.53
2	GTPBP4	23560	GTP binding protein 4	Nucleus	Ribosome biogenesis - small GTPase mediated signal transduction	2.00	2.91	-0.30
3	TFPI2	7980	Tissue factor pathway inhibitor 2	Extracellular matrix	Serine-type endopeptidase inhibitor activity	2.10	2.93	-0.27
4	CYP26A1	1592	Cytochrome P450, family 26,subfamily A, polypeptide 1	Membrane	Metal ion binding	2.31	2.39	-0.88
5	ZNF35	7584	Zinc finger protein 35 (clone HF.10)	Nucleus	Transcription factor activity	2.18	2.19	-0.66
6	RTTN	25914	Rotatin		required for left-right specification in mouse embryos	2.21	2.13	-0.58
7	FXYD3	5349	FXYD domain containing ion transport regulator 3	Membrane	Chloride channel activity	2.44	2.03	-0.15
8	CYYR1	116159	Cysteine/tyrosine-rich 1	Integral to membrane	Molecular function unknown	-2.30	-2.20	1.05
9	BFAR	512836	Bifunctional apoptosis regulator		Apoptosis regulator	-2.40	-2.17	1.06
10	C19orf4	25789	Chromosome 19 open reading frame 4	Integral to, membrane	Molecular function unknown	-2.51	-2.28	0.19
11	KIAA1305	57523	KIAA1305 protein		Hypothetical protein	-2.19	-2.29	0.55
12	PCDH9	5101	Protocadherin 9	Integral to membrane	Cell adhesion	-2.18	-2.30	0.50
13	IKIP	121457	IKK interacting protein			-2.23	-2.33	0.83
14	FLJ21963	79611	FLJ21963 protein		Hypothetical protein	-2.12	-2.37	1.88
15	SCRG1	11341	Scrapie responsive protein 1	Extracellular space	Nervous system development	-2.14	-2.54	0.74
16	ULK2	9706	Unc-51-like kinase 2 (C. elegans)		Similar to a serine/threonine kinase in C. elegans	-2.46	-2.72	0.26
17	LIFR	3977	Leukemia inhibitory factor receptor	Integral to plasma membrane	Receptor activity	-2.26	-2.96	0.29
18	BMF	90427	Bcl-2 modifying factor	Sequestrated by myosin	Apoptotic activator - protein binding	1.00	2.95	2.40
19	CD248	57124	CD248 antigen, endosialin		Marker of stromal fibroblasts	0.74	2.31	2.10
20	PPM1E	22843	Protein phosphatase 1E (PP2C domain containing)		Phosphatase	0.76	2.33	2.06
21	CARD8	22900	Caspase recruitment domain family, member 8		Involved in NFκB pathway	-0.59	-3.26	4.07

E.c., E. coli; L.p., L. plantarum.

Table 2 Modulation of gene expression during mixed (E. coli and L. plantarum) infection

Biological process	Gene symbol	Gene ID NCBI	Gene name	Fold change
Category 1: Regulation of transcription	HOXD10	3236	Homeobox D10	2.50
	PHF7	51533	PHD finger protein 7 (Zinc ion binding)	2.44
	EGR1	1958	Early growth response 1	-2.08
	TRIM24	8805	Tripartite motif-containing 24 (Zinc ion and DNA binding)	-2.15
	ENO1	2023	Enolase 1, (alpha) (DNA binding)	-2.34
Category 2: RNA processing	SSB	6741	Sjogren syndrome antigen B (autoantigen La)	-2.08
	FUSIP1	10772	FUS interacting protein (serine/arginine-rich) 1	-2.21
	NOLA5	10528	Nucleolar protein 5A (56 kDa with KKE/D repeat)	-2.27
	DDX5	1655	DEAD (Asp-Glu-Ala-Asp) box polypeptide 5	-2.71
Category 3: Protein biosynthesis, folding, binding and transport	NEURL	9148	Neuralized homolog (Intracellular protein transport)	2.91
	WDR36	134430	WD repeat domain 36	2.37
	MTFMT	123263	Mitochondrial methionyl-tRNA formyltransferase	2.04
	ARF4	378	ADP-ribosylation factor 4	-2.03
	CEP57	9702	Centrosomal protein 57 kDa	-2.11
	ETF1	2107	Eukaryotic translation termination factor 1	-2.27
	HSPA1A	3303	Heat shock 70 kDa protein 1A	-2.28
	LGALS3	3958	Lectin, galactoside-binding, soluble, 3 (galectin 3)	-2.75
	HSPH1	10808	Heat shock 105 kDa/110 kDa protein 1	-2.93
	HSPA8	3312	Heat shock 70 kDa protein 8	-2.97
Category 4: Structural protein	AMPH	273	Amphiphysin (Actin cytoskeleton)	3.04
	MAP1B	4131	Microtubule-associated protein 1B	2.13
	ABCC10	89845	ATP-binding cassette, sub-family C (CFTR/MRP), member 10	-2.05
	SLC26A2	1836	Solute carrier family 26 (sulfate transporter), member 2	-2.06
	TUBB2A	7280	Tubulin, beta 2A	-2.15
Category 5: Metabolism	C5orf14	79770	Chromosome 5 open reading frame 14	2.91
	NAV2	89797	Neuron navigator 2	2.83
	SLC24A4	123041	Solute carrier family 24 (sodium/potassium/calcium), member 4	2.35
	PLEKHM2	23207	Pleckstrin homology domain containing, family M, member 2	2.10
	TWF1	5756	Twinfilin, actin-binding protein, homolog 1 (Tyrosin kinase)	-2.01
	AKR1C1	1645	Aldo-keto reductase 1, member C1 (Bile acid binding)	-2.09
	HMGCR	3156	3-hydroxy-3-methylglutaryl-Coenzyme A reductase	-2.10
	DC2	58505	DC2 protein (Glycotransferase activity)	-2.12
	GSTA1	2938	Glutathione S-transferase A1	-2.15
	GAPD	2597	Glyceraldehyde-3-phosphate dehydrogenase	-2.16
	GCLC	2729	Glutamate-cysteine ligase, catalytic subunit	-2.21
	SRM	6723	Spermidine synthase	-2.39
	HSP90AA1	3320	Heat shock protein 90 kDa alpha (cytosolic), class A member 1	-2.46
	AHCY	191	S-adenosylhomocysteine hydrolase	-2.48
	MAT2A	4144	Methionine adenosyltransferase II, alpha	-2.74
Category 6: Cell physiology	NCF4	4689	Neutrophil cytosolic factor 4, 40 kDa	2.39
	CYCS	54205	Cytochrome c, somatic	-2.02
	DBI	1622	GABA receptor modulator, acyl-Coenzyme A binding protein	-2.25
	ATP5G3	518	ATP synthase, H+ transporting, mitochondrial F0 complex, subunit C3	-2.26
	HSPA1L	3305	Heat shock 70 kDa protein 1-like	-2.26
Category 7: Cell proliferation	FOSL1	8061	FOS-like antigen 1 (transcription factor activity)	-2.09
	FGG	2266	Fibrinogen gamma chain	-2.36
	FGG	2244	Fibrinogen beta chain	-2.45
Category 8: Cell adhesion	NELL2	4753	NEL-like 2 (Calcium ion binding)	2.25
	ITGB3	3690	Integrin, beta 3 (platelet glycoprotein IIIa, antigen CD61)	2.11
	RHOB	388	Ras homolog gene family, member B	-2.19
	ADRM1	11047	Adhesion regulating molecule 1	-2.25
Category 9: Ubiquitination	UBE2N	7334	Ubiquitin-conjugating enzyme E2N (UBC13 homolog, yeast)	-2.02
	UBE2S	27338	Ubiquitin-conjugating enzyme E2S	-2.05
	ANAPC7	51434	Anaphase promoting complex subunit 7	-2.15
	CACYBP	27101	Calcyclin binding protein	-2.18
	UBA52	7311	Ubiquitin A-52 residue ribosomal protein fusion product 1	-2.29
	COL6A3	1293	Collagen, type VI, alpha 3	2.33
	RPS3A	6189	Ribosomal protein S3A	-2.08
	TWF1	5756	Twinfilin, actin-binding protein, homolog 1 (Tyrosin kinase)	-2.01
	AKR1C1	1645	Aldo-keto reductase 1, member C1 (Bile acid binding)	-2.09

Negative value indicates reduction in gene expression.

Table 3 Primers used for RT-PCR

Gene symbol	Gene ID (NCBI)	Gene name	Gene role	Primer	Primer sequence 5’-3’
BMF	90427	Bcl2 modifying factor, transcript variant 1	Has a single Bcl2 homology domain 3 (BH3), binds Bclk2 proteins and functions as an apoptotic activator	F	GCTTCAGTTGCATTGCAGACCAGTT
				R	AGAGCCCTTGGGAATTCTCACCAT
CD248	57124	CD248 antigen = endosialin	A gene regulated by the cell density in vitro. Has a calcium binding domain	F	TCAACTACGTTGGTGGCTTCGAGT
				R	AGTTGGGATAATGGGAAGCTGGGT
PPM1E	22843	Protein phosphatase 1E	Member of the PP2C family of Ser/Thr phosphatases known to be negative regulators of stress response pathways	F	ATGCCTCCATTCACCTCCACGTTA
				R	TGTCATAGAAGCCATCACAGGCCA
FXYD3	5349	FXY domain containing ion transport reg. 3	The protein encoded by this gene may function as a chloride channel or as a chloride channel regulator	F	AATGCAAGTTTGGCCAGAAGTCCG
				R	TTGCATATGAGGTCCCATGGCTGA
OAS2	4939	2’-5’-oligoadenylate synthetase 2	This enzyme family plays a significant role in the inhibition of cellular protein synthesis	F	AGAAGCCAACGTGACATCCTCGAT
				R	TGCTGGAGTTCAGTGAAGCAGACT
FY	2532	Duffy blood group antigen	Helps in leukocyte recruitment to sites of inflammation by facilitating movement of chemokines across the endothelium	F	TGACTCTGCACTGCCCTTCTTCAT
				R	TTGACAACAGCAACAGCTTGGACC
CERK	64781	Ceramide kinase	Integral to membranes, has roles in arachidonic acid release and production of eicosanoids	F	TGAGAAGAAACGGTGGTTGGGTCT
				R	AGCATTTCCGGATGAGGATGAGGT
HPSE	10855	Heparanase	Cell surface expression and secretion markedly promote tumor angiogenesis and metastasis	F	ACCTTTGCAGCTGGCTTTATGTGG
				R	CTTGCACGCTTGCCATTAACACCT
GAPDH	2597	Glyceraldehyde-3-phosphate dehydrogenase	Used as reference	F	GACCACAGTCCATGCCATCAC
				R	GAGCTTCAGAAAGTGGTCGTTGA