CagA+ H pylori infection is associated with polarization of T helper cell immune responses in gastric carcinogenesis

Table 1 Sequences of cDNA primers for human IFN-γ, IL-4 and β-actin

Target	Sequences (5’→3’)	Length of amplicon (bp)
IFN-γ	Forward: CTTTAAAGATGACCAGAGCATCCAA	189 (372-560 NM000619.2)
	Reverse: GGCGACAGTTCAGCCATCAC
IL-4	Forward: GACTGTGCTCCGGCAGTTCTA	182 (589-770 NM000589)
	Reverse: CCAACGTACTCTGGTTGGCTTC
β-actin	Forward: ATTGCCGACAGGATGCAGA	89 (991-1079 CR609136.1)
	Reverse: GAGTACTTGCGCTCAGGAGGA

Table 2 The prevalence of H pylori infection and CagA classification

Pathological diagnosis	Gender		Age	H pylori positive			H pylori negative
	Male	Female	(yr, mean ± SD)	Overall (%)	CagA+ (%)	CagA- (%)
Normal mucosa (n = 61)	31	30	44.62 ± 12.41	48 (78.69)	37 (60.65)	11 (18.03)	13 (21.31)
Chronic gastritis (n = 268)	121	147	44.53 ± 14.37	232 (86.57)	170 (63.43)	62 (23.13)	36 (13.43)
Gastric atrophy (n = 114)	73	41	51.60 ± 12.39	104 (91.23)	88 (77.19)	16 (14.03)	10 (8.77)
Intestinal metaplasia (n = 104)	47	57	50.69 ± 12.81	95 (91.35)	80 (76.92)	15 (14.42)	9 (8.65)
Dysplasia (n = 71)	45	26	54.23 ± 12.25	65 (91.55)	57 (80.28)	8 (11.26)	6 (8.45)
Gastric cancer (n = 93)	70	23	64.70 ± 11.33	85 (91.40)	74 (79.57)	11 (11.83)	8 (8.60)
Total (n = 711)	387	324	50.18 ± 14.65	629 (88.47)	506 (71.16)	123 (17.30)	82 (11.53)

The prevalence of CagA+ H pylori was significantly associated with the progression of gastric pathology (r = 0.896, P = 0.016).

Table 3 Plasma cytokine contents in patients with CagA+ H pylori infection (mean ± SE, pg/mL)

Pathological diagnosis	IFN-γ	IL-4	IL-12	IL-10	IL-6	IL-2
Normal mucosa (NM, n = 37)	27.46 ± 1.05	10.86 ± 0.62	81.42 ± 1.89	66.92 ± 2.15	47.96 ± 1.99	54.17 ± 1.09
Chronic gastritis (CG, n = 170)	28.94 ± 0.59	11.22 ± 0.45	72.49 ± 0.93	80.65 ± 0.99	63.40 ± 1.57	45.95 ± 0.49
Gastric atrophy (GA, n = 88)	30.48 ± 0.75	11.23 ± 0.33	53.29 ± 0.79	100.80 ± 1.69	94.10 ± 2.57	39.61 ± 0.69
Intestinal metaplasia (IM, n = 80)	31.71 ± 1.02	12.08 ± 0.59	52.18 ± 0.94	104.18 ± 1.90	112.03 ± 2.64	34.07 ± 0.54
Dysplasia (DP, n = 57)	30.14 ± 1.04	10.92 ± 0.39	43.30 ± 1.10	157.72 ± 2.64	156.74 ± 3.66	32.71 ± 0.81
Gastric cancer (GC, n = 74)	31.00 ± 0.84	11.03 ± 0.29	39.10 ± 0.89	196.65 ± 1.83	159.32 ± 2.57	28.39 ± 0.65

There was no difference in the expression of IFN-γ and IL-4 in the plasma of CagA+ H pylori subjects among all the groups. There were significant differences for IL-12 among all the groups except between GA and IM (P = 1.000), DP and GC (P = 0.237). There were significant differences for IL-10 between all groups except between GA and IM (P = 1.000). For IL-6, there were significant differences among all the groups except between DP and GC (P = 1.000). For IL-2, there were significant differences among all the groups except between IM and GA, DP (P = 1.000, P = 1.000).

Table 4 Plasma cytokine contents in patients with CagA- H pylori infection (mean ± SE, pg/mL)

Pathological diagnosis	IFN-γ	IL-4	IL-12	IL-10	IL-6	IL-2
Normal mucosa (NM, n = 11)	29.28 ± 0.54	11.07 ± 0.89	82.17 ± 4.59	67.29 ± 3.26	48.37 ± 4.01	54.11 ± 2.87
Chronic gastritis (CG, n = 62)	29.19 ± 1.18	10.89 ± 0.27	64.59 ± 3.10	80.25 ± 1.87	57.99 ± 2.61	53.14 ± 1.25
Gastric atrophy (GA, n = 16)	30.25 ± 2.01	10.67 ± 0.67	49.67 ± 3.28	91.28 ± 3.19	92.56 ± 5.79	42.33 ± 2.32
Intestinal metaplasia (IM, n = 15)	28.91 ± 2.23	11.08 ± 0.74	48.19 ± 2.99	98.11 ± 4.08	98.20 ± 5.92	40.98 ± 2.38
Dysplasia (DP, n = 8)	31.08 ± 2.19	11.01 ± 1.27	42.64 ± 5.49	157.09 ± 6.81	147.65 ± 6.89	34.79 ± 3.05
Gastric cancer (GC, n = 11)	28.06 ± 2.45	12.07 ± 0.91	38.97 ± 3.29	185.29 ± 9.38	154.68 ± 6.78	30.29 ± 2.11

There was no difference in the expression of IFN-γ and IL-4 in plasma of subjects with CagA- H pylori infection among all the groups (P_all > 0.05). For IL-12, there were significant differences between CG and GA, IM, DP, and GC (P < 0.05, P < 0.05, P < 0.05, P < 0.001). For IL-10, there were significant differences between all the groups except between GA and CG and IM (P_all > 0.05). For IL-6, there were significant differences among all the groups except between GA and IM (P = 1.000) and DP and GC (P = 1.000). For IL-2, there were significant differences between CG and GA, IM, DP, and GC (P_all < 0.001) and between IM and GC (P < 0.05).

Table 5 Plasma cytokine contents in patients without H pylori infection (mean ± SE, pg/mL)

Pathological diagnosis	IFN-γ	IL-4	IL-12	IL-10	IL-6	IL-2
Normal mucosa (NM, n = 13)	31.83 ± 0.17	10.57 ± 0.68	80.84 ± 4.81	68.56 ± 3.87	49.53 ± 3.94	53.13 ± 1.48
Chronic gastritis (CG, n = 36)	29.10 ± 1.27	10.37 ± 0.30	68.57 ± 2.43	79.03 ± 1.64	57.66 ± 2.56	52.54 ± 1.41
Gastric atrophy (GA, n = 10)	29.06 ± 1.93	10.49 ± 0.58	51.14 ± 3.47	90.94 ± 3.63	91.08 ± 6.11	41.39 ± 2.18
Intestinal metaplasia (IM, n = 9)	28.57 ± 2.72	11.75 ± 0.61	50.97 ± 1.54	97.60 ± 3.53	96.35 ± 5.19	41.54 ± 0.99
Dysplasia (DP, n = 8)	31.59 ± 1.29	11.46 ± 0.58	43.10 ± 5.02	153.34 ± 6.12	149.92 ± 6.23	35.00 ± 2.04
Gastric cancer (GC, n = 6)	27.04 ± 2.30	11.91 ± 1.26	40.06 ± 2.08	181.36 ± 9.02	153.04 ± 6.63	30.95 ± 1.91

There was no difference in the expression of IFN-γ and IL-4 in plasma of subjects without H pylori infection among all the groups (P_all > 0.05). For IL-12, there were significant differences between CG and GA, IM, DP, and GC (P = 0.006, P = 0.009, P = 0.001, P < 0.001). For IL-10, there were significant differences between all the groups except between GA and CG and IM (P = 0.219, P = 1.000). For IL-6, there were significant differences among all the groups except between GA and IM (P = 1.000) and DP and GC (P = 1.000). For IL-2, there were significant differences between CG and GA, IM, DP, and GC (P_all < 0.001) and between IM and GC (P = 0.037).