Effects of intra-gastric beta-casomorphin-7 on somatostatin and gastrin gene expression in rat gastric mucosa

Table 1 Nucleotide sequences of specific primers and PCR conditions

Target genes	GenBank accession	PCR products	Primer sequences	PCR conditions
Gastrin	M38653	315 bp	F: 5'- CCTACTGCCACAACAGTTAA -3'	94°C, 30 s; 52°C, 30 s; 72 °C, 60 s; 32 cycles
			R: 5'- CATCCATCCGTATGCTTC -3'
Somatostatin	M25890	330 bp	F: 5'- ATGCTGTCCTGCCGTCTC -3'	94°C, 30 s; 60°C, 30 s; 72 °C, 60 s; 30 cycles
			R: 5'- CAGCCAGCTTTGCGTTCC -3'
β-actin	AF122902	200 bp	F: 5'- CCCTGTGCTGCTCACCGA -3'	-
			R: 5'- ACAGTGTGGGTGACCCCGTC -3'

Table 2 G cells of gastric mucosa in adult rats (n = 8, mean ± SE)

Group	Oxyntic gland		Pyloric gland
	Number of cells	Even grey	Number of cells	Even grey
Control	93.0 ± 3.3	82.80 ± 2.24	103.2 ± 2.2	79.06 ± 0.69
βCM7	113.4 ± 1.4a	89.91 ± 3.00	121.3 ± 3.4a	90.18 ± 2.92a
Poly-Gly	97.0 ± 5.4	89.68 ± 1.50	99.7 ± 2.2	96.85 ± 4.18b

^aP < 0.05 vs control group,

^bP < 0.01 vs control group.

Table 3 D cells of gastric mucosa in adult rats (n = 8, mean ± SE)

Group	Oxyntic gland		Pyloric gland
	Number of cells	Even grey	Number of Cells	Even grey
Control	69.8 ± 3.4	98.95 ± 5.30	79.7 ± 1.9	108.32 ± 7.03
βCM7	69.6 ± 3.2	77.16 ± 1.98a	78.0 ± 3.2	87.25 ± 3.84b
Poly-Gly	70.2 ± 2.9	88.24 ± 4.91	78.8 ± 2.4	109.43 ± 5.74

^aP < 0.05 vs control group,

^bP < 0.01 vs control group.