In vitro resistance to interferon of hepatitis B virus with precore mutation

Table 1 Sequences of primers for mutagenesis reaction.

Primer	Direction	Length	Position (nt)	5’-sequence-3’
A1762/G1764For	+	34	1748-1781	aggagattagttaaaggtctttgtactaggaggc
1896/1899Rev	-	20	1895-1876	aaagccacccaaggcacagc
A1896For	+	31	1876-1906	gctgtgccttgggtggctttagggcatggac
A1899For	+	34	1876-1909	gctgtgccttgggtggctttgggacatggacatt
A1896A1899For	+	34	1876-1909	gctgtgccttgggtggctttaggacatggacatt
PS5For	+	20	1260-1279	gccgatccatactgcggaac
PS4Rev	-	20	2386-2405	gagaccttcgtctgcgaggc

Table 2 Mutation patterns of the 4 recombinant constructs.

Number	Recombinant constructs	Mutation pattern
		A1896	A1899
1	pUC18-HBV1.2-WT	-	-
2	pUC18-HBV1.2-A1896	+	-
3	pUC18-HBV1.2-A1899	-	+
4	pUC18-HBV1.2-AA	+	+

Note: “+” indicates the construct containing the corresponding mutation, “-” indicates the constructs containing no corresponding mutation instead of wild type.

Table 3 HBsAg and HBV DNA secreted into cell culture medium with or without IFN (mean±SD).

Recombinants	HBsAg (A450)		HBV DNA (realtime PCR, log10)
	Without IFN	With IFN	Without IFN	With IFN
Puc18-HBV1.2-WT	2.63±0.1c	1.96±0.07c	5.02±0.06ac	4.86±0.07c
Puc18-HBV1.2-A1896	1.43±0.05	1.46±0.07	4.43±0.09ac	5.53±0.07c
Puc18-HBV1.2-A1899	1.97±0.15	1.96±0.12	4.80±0.05	4.90±0.06
Puc18-HBV1.2-AA	2.6±0.05	2.5±0.06	4.06±0.07ac	4.46±0.05c

n = 3,

^aP<0.05 (WT in comparison with MT without IFN),

^cP<0.05 (without IFN in comparison with with IFN). WT: wild type, MT: mutated type.