NOD2/CARD15 gene polymorphism in patients with inflammatory bowel disease: Is Hungary different?

Table 1 Primers and Probes used in genotyping of NOD2/CARD15 genetic variants.

SNP	Primers	Probes	Annealing
Arg702Trp	TTCCTGGCAGGGCTGTTGTC	FAM-CCTGCTCCGGCGCCAGGC-TAMRA	64.5 °C
	GTGGAAGTGCTTGCGGAGG	TET-CCTGCTCTGGCGCCAGGCC-TAMRA
Gly908Arg	ACTCACTGACACTGTCTGTTGACTCT	FAM-TTTTCAGATTCTGGGGCAACAGAGTGGGT-TAMRA
	AGCCACCTCAAGCTCTGGTG	TET-TTCAGATTCTGGCGCAACAGAGTGGGT-TAMRA
3020insC	GTCCAATAACTGCATCACCTACCTAG	FAM-CCCTCCTGCAGGCCCTTGAAAT-TAMRA	62.5 °C
	CTTACCAGACTTCCAGGATGGTGT	TET-CCTCCTGCAGGCCCCTTGAAA-TAMRA

Table 2 NOD2/CARD15 genotypes and allele frequencies in Hungarian IBD patients.

	Patients	Genotypes			Allele frequency (%)	P value1
		-/- n (%)	-/+ n (%)	+/+ n (%)
Arg702Trp	CD	129 (87.2)	17 (11.5)	2 (1.4)	7.1	0.011
	UC	120 (93.8)	8 (6.3)	0	3.1	0.072
	Controls	197 (94.7)	11 (5.3)	0	2.6	n.s.3
Gly908Arg	CD	139 (93.9)	9 (6.1)	0	3	0.101
	UC	124 (96.9)	4 (3.1)	0	1.6	0.272
	Controls	203 (97.4)	5 (2.6)	0	1.2	n.s.3
1007finsC	CD	122 (82.4)	22 (14.9)	5 (3.4)	10.8	<0.00011
	UC	122 (95.3)	6 (4.7)	0	2.3	0.0012
	Controls	199 (95.7)	9 (4.3)	0	2.2	n.s.3

Crohn’s disease (CD, n = 148), ulcerative colitis (UC, n = 128) and controls (n=208); Genotypes: -/- homozygous wild-type, -/+ heterozygous mutant, +/+ homozygous mutant; Absolute numbers (percentages) of individuals negative (-/-), heterozygous (-/+), homozygous (+/+) for the different NOD2/CARD15 mutations (Arg702Trp, Gly908Arg and 1007finsC) are shown. Fisher’s exact test was performed comparing percentages of patients positive or negative for the corresponding NOD2/CARD15 mutation between

¹CD and controls,

²CD and UC,

³UC and controls.

Table 3 Clinical characteristics of Crohn´s disease patients.

Genotype	1007finsC (+)	1007finsC (-)
Total Number	27	121
Male: female	11:16	57:64
Age at diagnosis (yr)
Range	13-46	12-65
mean±SD	25.9±8.0	30.1±12.8
Race, n (%)
Caucasian	26 (96.3)	112 (92.6)
Roma (Gipsy)	1 (3.7)	9 (7.4)
Disease Duration (yr)	9.1±6.9	8.5±8.1
Familial Crohn’s disease, n (%)	1 (3.7)	9 (7.4)
Sporadic Crohn’s disease, n (%)	26 (96.3)	112 (92.6)
Smoking Habits, n (%)
Never	15 (55.6)	69 (57.0)
Current	11 (40.7)	48 (39.7)
Ex-Smoker	1 (3.7)	4 (3.3)
Localisation, n (%)
Upper GI	3 (11.1)	4 (3.3)
Ileum	18 (66.7)	62 (51.2)
Colon	20 (74.1)	103 (85.1)
Perianal Disease	7 (26.0)	5 (28.9)
Behaviour, n (%)
Inflammatory	2 (7.4)1	47 (38.8)
Stricturing	17 (63.0)2	40 (33.0)
Penetrating	12 (44.4)	46 (38.0)
Surgery, n (%)
Ileal resections	14 (51.9)3	21 (17.4)
Colonic resections	7 (26.0)	21 (17.4)
Fistulae	1 (3.7)	3 (2.5)
Extraintestinal manifestation, n (%)
Arthritis	3 (11.1)	17 (14.0)
Primary sclerosing cholangitis	0	2 (1.7)
Skin	0	7 (5.8)
Eye	0	1 (0.8)

¹Inflammatory disease behaviour was negatively correlated to the 1007finsC mutation (P = 0.001, Fisher’s exact test).

²Stenotic disease behaviour was significantly associated with the 1007finsC mutation (P = 0.008, Fisher’s exact test).

³Ileal resections were performed significantly more often in patients positive for the 1007finsC mutation (P = 0.001, Fisher’s exact test). No other significant differences were found.