Construction of eukaryotic expression vector of HBV x gene

Abstract

Key Words: HBV x gene, carcinoma, hepatocellular, expression vector, liver neoplasms, gene expression

INTRODUCTION

Chronic infection with hepatitis B virus is closely related to liver diseases, including hepatocellular carcinoma. Hepatitis B virus x gene and its product HBx Ag possibly play an important role in carcinogenesis of hepatocellular carcinoma. HBV x gene can integrate into cellular DNA during chronic infection[1]. HBx Ag overexpression may alter signal transduction pathways of hepatocyte[2]. HBx Ag can bind to and inactivate negative growth-regulatory molecules such as tumor suppressor p53[3], suggesting its role in hepatocarcinogenesis.

We have constructed the HBV x gene eukaryotic expression vector in order to study its contribution to chronic hepatitis and hepatocellular carcinoma.

MATERIALS AND METHODS

Plasmids

Plasmids p^TTHK containing HBV DNA and p^T7Blue were provided by Dr. ZHANG Huai-Zhong. PCR primers were synthesized by Shanghai Shengon Biology Coporation. Plasmid p^CDNA3.1 was obtained from our department.

Enzymes and bacterial cells

All restriction enzymes and T4 DNA ligase were purchased from Hua Mei Coporation. E. coli JM109 and DH5 α were obtained from our department.

Construction of p^T7Blue-HBX

Polymerase chain reaction (PCR) was used to obtain HBV x gene from the plasmid p^TTHK. The sequence of primers was as follows. The restriction enzyme sites of EcoR I and Kpn I were added at 5′ end of upper and lower primers respectively.

5′ATCGGTACCATGGCTGCTAGGCTG 3′

5′GGAGAATTCATGATTAGGCAGAGGTG 3′

The condition of PCR is 94 °C 5 min, 59 °C 1 min, 74 °C 1 min, 30 cycles and 74 °C 10 min. The PCR results are shown in Figure 1. The PCR product was recovered from the low melting agarose gel and was digested by endonuclease EcoR I and Kpn I simultaneously and was ligated to plasmid p^T7Blue with T4 DNA ligase. After recombinant plasmid p^T7Blue-HBX- was introduced into DH5 α, seven ampicillin resistant clones were selected and the plasmid DNA was extracted. The correct plasmids identified by the restriction analysis were sequenced.

Figure 1 The PCR product of HBV x gene. Lane 1: λDNA/Hind III marker; Lane 2-6: the PCR product of HBV x gene.

Construction of eukaryotic expression vector p^CDAN3.1-HBX

Plasmid p^CDNA3.1 and p^T7Blue-HBX were digested by endonuclease EcoR I and Kpn I. 480 bp fragment of HBX and 5.4 kb fragment of p^CDNA3.1 were recovered from the low melting point agarose gel re spectively. They were ligated by T4 DNA and named p^CDNA3.1-HBX. The recombinant DNA was introduced into DH5 α. Eight clones were selected an d correct plasmids were identified by combinative digestion of EcoR I and Kpn I. One colony exhibited 480 bp and 5.4 kb was in right junction named p^CDAN3.1-HBX.

RESULTS

Construction of p^T7Blue-HBX

In order to construct the eukaryotic expression vector of HBV x gene, we first constructed the vector p^T7Blue-HBX. The PCR result and the gene structure of recombinant plasmid are shown in Figure 1 and Figure 2. The result of the sequence is shown in Figure 3.

Figure 2 The structure of recombinant plasmid p^T7Blue-HBX. Lane 1: λDNA/Hind III marker; Lane 2-3: p^T7Blue-HBX combinative digested by EcoR I and Kpn I; Lane 4: p^T7Blue combinative digested by EcoR I and Kpn I; Lane 5: p^T7Blue-HBX.

Figure 3 The sequence result of p^T7Blue-HBX.

Construction of eukaryotic expression vector p^CDNA3.1-HBX

On the basis of correct sequence result of p^T7Blue-HBX, we inserted HBV x gene at the sites of EcoR I and Kpn I of p^CDNA3.1 to construct the eukaryotic expression vector p^CDNA3.1-HBX. The recombinant plasmid gene structure is shown in Figure 4.

Figure 4 The structure of p^CDNA3. 1-HBX.Lane 1.2: p^CDNA3.1-HBX combinative digested by EcoR I and Kpn I; Lane 3: λDNA/EcoR I marker.

DISCUSSION

Hepatitis B virus (HBV) is a formidable threat to public health. HBV associated HCC is one of the 10 commonly encountered cancers in the world. The relative risk of HBV carriers developing HCC approaches 200:1, which is one of the highest relative risks known for a human cancer[4]. HBV x gene and x antigen may play an important role in the development of chronic infections and chronic liver disease. HBV can integrate into cell DNA and the HBV x region is the most frequently integrated sequence[1]. These integrated fragments make HBV encode x antigen that is capable of trans activation both in vitro and in vivo[5]. HBx Ag can stimulate the cell growth directly[6], and inactivate the negative growth regulators, such as tumor suppressor p53 [2]. Furthermore, HBx Ag can increase the resistance of HBx Ag-positive cells to apoptosis mediated by cytotoxic cytokine through altering signal transduction pathway of hepatocyte[2].

In conclusion, the topic of HBV is an old but important one, and is worthy of further studies. We have constructed the eukaryotic expression vector of HBV x gene for this study.