Rapid Communication Open Access
Copyright ©2007 Baishideng Publishing Group Co., Limited. All rights reserved.
World J Gastroenterol. Feb 21, 2007; 13(7): 1090-1097
Published online Feb 21, 2007. doi: 10.3748/wjg.v13.i7.1090
Frequent loss of heterozygosity in two distinct regions, 8p23.1 and 8p22, in hepatocellular carcinoma
Tomoe Lu, Hiroshi Hano, Chenxi Meng, Keisuke Nagatsuma, Satoru Chiba, Masahiro Ikegami, Department of Pathology, Jikei University School of Medicine, Tokyo, Japan
Author contributions: All authors contributed equally to the work.
Supported by The Jikei University Research Fund
Correspondence to: Tomoe Lu, MD, PhD, Department of Pathology, The Jikei University School of Medicine, 3-25-8 Nishishinbashi, Minato-ku, Tokyo 105-8461, Japan. luwei@jikei.ac.jp
Telephone: +81-3-34331111-231 Fax: +81-3-54720700
Received: November 25, 2006
Revised: December 16, 2006
Accepted: January 18, 2007
Published online: February 21, 2007

Abstract

AIM: To identify the precise location of putative tumor suppressor genes (TSGs) on the short arm of chromosome 8 in patients with hepatocellular carcinoma (HCC).

METHODS: We used 16 microsatellite markers informative in Japanese patients, which were selected from 61 published markers, on 8p, to analyze the frequency of loss of heterozygosity (LOH) in each region in 33 cases (56 lesions) of HCC.

RESULTS: The frequency of LOH at 8p23.2-21 with at least one marker was 63% (20/32) in the informative cases. More specifically, the frequency of LOH at 8p23.2, 8p23.1, 8p22, and 8p21 was 6%, 52%, 47%, and 13% in HCC cases. The LOH was significantly more frequent at 8p23.1 and 8p22 than the average (52% vs 22%, P = 0.0008; and 47% vs 22%, P = 0.004, respectively) or others sites, such as 8p23.2 (52% vs 6%, P = 0.003; 47% vs 22%, P = 0.004) and 8p21 (52% vs 13%, P = 0.001; 47% vs 13%, P = 0.005) in liver cancer on the basis of cases. Notably, LOH frequency was significantly higher at D8S277, D8S503, D8S1130, D8S552, D8S254 and D8S258 than at the other sites. However, no allelic loss was detected at any marker on 8p in the lesions of nontumor liver tissues.

CONCLUSION: Deletion of 8p, especially the loss of 8p23.1-22, is an important event in the initiation or promotion of HCC. Our results should be useful in identifying critical genes that might lie at 8p23.1-22.

Key Words: Loss of heterozygosity, Chromosome, Hepatocarcinogenesis, Hepatocellular carcinoma, 8p



INTRODUCTION

Primary liver cancer is one of the most frequent neoplasms worldwide, with both an incidence and a mortality rate that are increasing markedly. According to a recent report, the global number of new cases annually rose from 437 400 to 564 000 between 1990 and 2000, and is expected to continue to rise in the future[1-4].

Hepatocellular carcinoma (HCC), the predominant histological subtype of primary liver cancer, mostly arises against a background of chronic liver disease, usually in association with cirrhosis. Several risk factors for HCC have been reported, such as chronic infection with hepatitis B virus (HBV), and C virus (HCV) or both, alcohol-induced liver injury, and dietary exposure to aflatoxin B1 and others. Prolonged exposure to these risk factors is thought to cause an accumulation of chromosomal aberrations and altered gene expression, and eventually results in hepatocarcinogenesis[4-6]. In Japan, more than 70% of HCCs develop in patients with chronic infections with HCV[7]. Carcinogenesis is mainly researched based on virology and the viral gene itself. However, the mechanisms by which inflammation and cirrhosis contribute to tumor development and/or progression remain unclear. After the human genome was sequenced, the mechanism of generation and subsequent progression was researched at a molecular level for HCC. Histological findings suggest that the initiation and subsequent development of HCC are multistep processes involving qualitative and quantitative changes in sequentially expressed genes, especially the inactivation of tumor suppressor genes (TSGs) related to the deletion of chromosomal regions critical for hepatocarcinogenesis[8,9]. A typical alteration in many TSGs, the mutation of one allele, can be detected as a loss of heterozygosity (LOH) with informative markers in TSG regions. Therefore, LOH assays have been widely used as an indirect approach in the search for a new TSG[10]. In the last few years, genetic approaches to the detection of genome-wide LOH using microsatellite markers and chromosomal aberrations detected by comparative genomic hybridization (CGH) have indicated that frequent allelic loss in many different chromosomal regions, including 1p[11,12], 3p[13], 4q[14], 6q[15], 8p[16-19], 9p[20], 10p[21], 13q[22], 22q[23], 16q, 17p and Xq[24,25] , is closely associated with the tumorigenesis of HCC.

We have performed a genome-wide search for LOH with human genetic markers in several types of human cancer and confirmed that loss of 8p is the most frequent chromosomal alteration in prostate cancer, especially allelic loss at 8p22, which not only is an important event in the initiation of tumor, but also is closely associated with the progression of primary cancer to metastatic cancer[26].

In our comprehensive allelotyping, less than 30% of microsatellite markers located at 8p21-23, were recognized as informative for Japanese patients. We therefore undertook an allelotype based study of 33 HCCs using the selected informative markers to obtain a comprehensive view of the LOH on the most frequent altered chromosome, and to identify the location of the putative TSGs in HCC.

MATERIALS AND METHODS
Tissue collection, histopathology, and DNA extraction

Thirty-three patients with hepatocellular carcinoma who underwent liver resection were included in this study. Of these, fifty six tumor lesions and 33 adjacent morphological non-tumor lesions were obtained from surgically resected specimens. All specimens were formalin-fixed, and paraffin wax-embedded tissues were processed with routine histological methods. Use of the tissues was approved by the Ethics Committee of the Jikei University School of Medicine before the study. The study group included 26 men and 7 women, ranging in age from 31 to 76 years. Of the 33 patients, 24 (73%) had a chronic infection with HCV, HBV or both and 15 (45%) had cirrhosis in the background liver tissues. Histological diagnoses were made according to the WHO Histological Classification of Tumors of the Liver and Intrahepatic Bile Ducts (2000). According to histological grade, HCC was classified into well differentiated (WD), moderately differentiated (MD), and poorly differentiated (PD) types. In this study, clinicopathological characteristics were also classified, such as solitary or multiple tumor, growth pattern of tumor (expansive or infiltrative), infiltration of capsule or not, histological grading of tumor (well, moderately or poor differentiation), and with or without vascular and bile duct infiltration. Simultaneously, we also compared LOH frequency and etiological factors, such as chronic hepatitis with HCV or HBV infection, and cirrhosis in the background liver tissues. Fibrosis degree was classified as F1, F2, F3, and F4 according to the histological grading and staging of chronic hepatitis. In this system, liver cirrhosis was classed as F4, which is the end-stage form of liver fibrosis. Of the 33 patients who underwent liver resection, 18 had a solitary tumor nodule and 15 had multiple tumor nodules. All lesions from each case were selected and reviewed by two pathologists in order to confirm the original diagnosis. The tumor (T) and corresponding non-tumor hepatocytes (H), and remaining nonhepatocytes that were portal vein lesions (P) were micro-dissected from 15-μm tissue specimens after deparaffinization and nuclear staining. Normal tissues were obtained from the gallbladder or lymph nodes collected from the same patients (Figure 1). DNA was extracted using the standard phenol/chloroform method as described previously[26].

Figure 1
Figure 1 Representative examples of LOH in two cases of hepatocellular carcinoma (N: normal; H: hepatocytes; P: portal vein; T: tumor; number beside T indicates different lesion): case 7 showing partial loss of upper alleles in lesions of tumor 1 and tumor 2 but not in lesions of hepatocytes and portal vein at D8S1130; case 20 showing complete loss of upper alleles in lesion of tumor but not in surrounding non-tumor tissues at D8S503.
LOH analysis

Matched tumors, corresponding non-tumor liver tissues, and normal tissue DNAs were analyzed for LOH by amplification of polymorphic microsatellite markers using the polymerase chain reaction (PCR). Sixty-one published microsatellite markers, located at 8p23.3, 8p23.2, 8p23.1, 8p22, and 8p21, were selected from the Genome Database (available at http: //http://www. gdb. org). A total of 16 microsatellite markers were identified as informative in Japanese patients and used (Table 1).

Table 1 Informative microsatellite markers were selected and used in this study.
No.LocusMarkersGenetic map(cM)ForwardReversePCR productsize (bp)result1
18p23.3D8S7Not listedACCCTGACAGCAGAGGTTTCACCCTGACGTTCTCCCAGTA250-252ni
28p23.2D8S1164Not listedCACAAATCAGATTTTTGAAGTTGCGGGTTAGACGGACAACCTCA225ni
38p23.2D8S2640.7ACATCTGCGTCGTCTTCATACCAACACCTGAGTCAGCATA121-145in
48p23.2D8S2624.3AGCTCAAAAGCGAAGGTGATGGCAACAAAGTGAGATCCTG114-128in
58p23.1sts-X53793Not listedTCGACTACCCAGTGGTCTTGGTTCAAAATGCTTGCTCGC127ni
68p23.1D8S1742Not listedCCCCCACCAAGACACACTCAAGGGATATGAAGGGCA130in
78p23.1D8S2778.2GATTTGTCCTCATGCAGTGTACATGTTATGTTTGAGAGGTCTG121in
88p23.1D8S1918Not listedGAATGTCATGCTGGGAACGGTAGCTCTCAAAGCAAATTATGAGC108ni
98p23.1D8S181910TCACTGAGGGACTTGGCCGTGCTGAGAATGAGACC207in
108p23.1D8S1140Not listedGACAACATCCGATAATGCTGGAGGACATCTAGATAATTGGAAGA378ni
118p23.1D8S50316.2GGTTACGAGTTTTGTCCTTTGGAAACAAACCAATGTAGGAGTG136in
128p23.1D8S1672Not listedAACTGAGATCACGCCACTCCCCCATTGGTTTTAGAGTGGC149ni
138p23.1AFM234ve1Not listedTACCGCAAAACACACCAGCAGCCTTAGTTGACAACA245ni
148p23.1D8S2045Not listedCCGATTGCTTCATCGGGACCGCCTCCTCCTCTGAAATCCT120ni
158p23.1D8S113022.4GAAGATTTGGCTCTGTTGGATGTCTTACTGCTATAGCTTTCATAA145in
168p23.1D8S1946Not listedGCACAAGATCAGAGAGGTTGTGGAGGAGAGATGGTGTTGGGA102ni
178p23.1D8S1640Not listedTGCAGTCTGCGGGAGTTCAGCAGGGTGACTGTAAAGAAGG175ni
188p23.1D8S2060Not listedCTCTCCGGGAATGTAATACTGCGAGCTGGGAGTTACTGCCTG256ni
198p23.1D8S55226.4CCTGTACCATACCCCTGTATCAAGGTTTGAATCTCTCAGTGG132in
208p23.1D8S110926.4TTCTCAGAATTGCTCATAGTGCTCAGCTCCTCTTCTGCTGAT241in
218p23.1D8S2066Not listedTTTTCTCCATCCGGTGACTCCCAACTACGGCATGGTTTCT175ni
228p23.1-22D8S110626.5TTGTTTACCCCTGCATCACTTTCTCAGAATTGCTCATAGTGC149ni
238p22D8S1451Not listedAACCTAAGGTTCTGTGCTACATCAAACTTACCAAGGCCGTTTAGG149ni
248p22EST465487Not listedTTTGTTTGGGTGGAGGACTCTGGACATCTGCCTAGGTCCT250ni
258p22D8S1647Not listedCCAGAATTTTGAAATAGATTCATCCAAATTTTGTAAATATCAGTGTTCCG174ni
268p22stSG2938832GCAGTGAGATTTTGCTTCTGGATGAACATTCAATGAATCAGCA125ni
278p22D8S1713Not listedCAGGGGCTGATTGTCAGAACGTGGCTGTCACCAAGGTCTC113ni
288p22SGC33312Not listedAGGGCCTTGGGAACACTCTCAGTTTAAATGGATGGTTTTTACT137ni
298p22D8S2080Not listedGACTCAAAGAGAACCTGCCGTAGGTTGGTGAGCACACGTC132ni
308p22D8S2081Not listedACCCAGTTACAGCACTGTAATATCACTCTACCCCGAAATGATGGA147ni
318p22SHGC-24261Not listedAAGCAGAGATAAGCCCGACATTTCTTTAGATGGAGTCCATTGC123ni
328p22SHGC-52401Not listedACAGGATAGTGTTAGGCTCACATGCATTCTCTGTATCTTTTGGGGG120ni
338p22D8S254Not listedTGCCGGACATACATTAGTGATTGTAAACACCACAAGCAGG65-75in
348p22D8S2001Not listedGACATTGAATTCCAGTATTTGTGCGGACAAATGCCACTGCAAC138ni
358p22SHGC-5873Not listedGACACACACATACAGAAAACCACTTACCATGAATGGAGCTTG225ni
368p22D8S26135.8TGCCACTGTCTTGAAAATCCTATGGCCCAGCAATGTGTAT128in
378p22AFM234vf4Not listedGGGCACAGGCATGTGTGGCTGCATTCTGAAAGGTTA260-272ni
388p22D8S1948Not listedTTACAAAACATACCCAGTGTTTGGCTTTTTAGTGCTTGAGACTGTCTCC110ni
398p22D8S2028Not listedTCAAAAGTTTTGTTTCTATTCAGGGTTTTTTCTGTTCCCCTCCG178ni
408p22D8S25840.3CTGCCAGGAATCAACTGAGTTGACAGGGACCCACG144-154in
418p22D8S1949Not listedTGTCTTACAGCTCTCCCTCTCCCAGTAAGGATCACCAAGACAAGG106ni
428p22D8S1983Not listedATTGGAAGAGGCAAATGGTGTATGTACTGGATGAAGCAGGACA175ni
438p22D8S1786Not listedCGAAAGATTGAGACCCCATGTTTCCACACCGAAGCC209ni
448p22D8S29842.7AGGCTTACACCCATGGACCACGCAGCACACAACATCAT155-167in
458p21.3D8S2050Not listedTGCCAATATCAGTGGAAGAGGTCCTTTTTCCCTTGTTGCC162ni
468p21.3D8S1752Not listedTCCTGGATCAGGCAGAAATCAGAGTTGGGTGAGCGA140in
478p21.3D8S173444.9GCTATCCACTTGTCCCAGAAGCCCAGAAATAAACCCTC114in
488p21.2D8S2256Not listedGTGTCTTGAGATACTGGTGAGAGAAATGTCTTTGTTGAGG101ni
498p21.2D8S2259Not listedTGAAAGCCTGTTTAGAGAGACTATTGCCCTGTGTTTTGCC105ni
508p21.2D8S1220Not listedTTCCGTATACACATGCACCCTAGCAGCCAGACACAGGAGC90ni
518p21.1D8S1445Not listedGCAACAGAGCGAGACTCCGTCAAGCTTACATTCTGGGTGAC117-139in
528p21.1D8S2261Not listedGTATTTATTCCACAAGCATCTTACAACCCCATCAGTCTCTCTAAT204ni
538p21.1D8S1444Not listedTTCTTCTAGATTTCCTACTACATTTGTTAAAAGTACAACC91x
548p21D8S2249Not listedTCCACCCATTTCAGCCTTTCCTAAAACATTTAACTTTCATT101ni
558p21D8S2248Not listedATACAGGTAGGTGAGGGCAATTCTGATGCTCTTCTGGAGT136ni
568p21D8S2247Not listedCATTGTGGTGGAGGTCGGAGTTCCCCCATCCCATCTGAG122ni
578p21D8S2262Not listedATGTTTTGTTCATGGGTCTTTAAGAAAAAGGGAAGGGGCAGT98ni
588p21D8S339Not listedTAGATGTTACCATTTCACGATTAGATCTTGGATCAG162ni
598p21D8S2245Not listedCCTCTTTATCCCACTTTTCAGCATTTTACGAATATAAGCATCC138ni
608p21D8S2244Not listedACAACTAAAGGACTTAAAGGGACAAGAAAAGAACAAATGG145ni
618p21D8S2246Not listedTAACCTGTGAATGAGAATACTGACAGTTTTGAGAGAATCC169ni

DNA amplification was performed in 10-μL volumes containing 100 ng of genomic DNA as a template. Each PCR mixture contained 1.5 mmol/L MgCl2, 100 μmol/L forward and reverse primers, 200 μmol/L each of dATP, dGTP, dTTP and dCTP, 10 μCi of [α-32P] dCTP (6000 Ci/mmol, Amersham, Biosciences Corp., Piscataway, NJ), 1 U of Taq DNA polymerase (Wako Pure Chemical Industries, Ltd., Osaka, Japan), and 1 × PCR buffer. After the initial denaturation at 94°C, 35 PCR cycles, each consisting of denaturation at 94°C for 30 s, annealing at 65°C-50°C for 30 s, elongation at 72°C for 1 min, and a final extension at 72°C for 5 min, were performed in a 96-well Hybaid thermocycler (Gene Amp PCR System 9600, Takara, Tokyo, Japan). Ten microliters of PCR products were denatured with 30-60 μL of dye solution (95% formamide, 10 mmol/LEDTA (pH 8.0), 0.2% xylene cyanol FF, and 0.02% bromophenol blue) at 95°C for 3 min and then cooled on ice immediately. Three microliters of denatured products were separated on a 6% urea-formamide-polyacrylamide gel and electrophoresed at 40 W for 2-3 h at room temperature. The dried gel was exposed to Hyperfilm MP (Amersham Biosciences Corp.) for 3-7 d and reexposed to another film for 2-3 wk.

Criteria for LOH

A pair of regular and longer-exposed autoradiographs was reviewed independently by two of the authors (T. L. and CX. M.). Informative pairs were judged by visual inspection to show LOH, no loss or to be noninformative.

LOH was defined as a loss of intensity of 60% or greater in 1 or more alleles in the tumor (T) or corresponding hepatocytes (H) compared with the identical allele in the normal tissue (N) (Figure 1).

Statistical analysis

The differences in LOH frequency between tumor, nontumor and normal tissues for individual markers and background values were determined with Fisher’s exact test.

RESULTS

The distribution of the frequency of LOH at 8p23.2, 8p23.1, 8p22 and 8p21 for hepatocellular carcinoma is shown in Table 2. Allelic loss at 8p23.2-21 was detected with at least 1 marker in 18 of 32 (56%) cases of liver cancer. More specifically, the frequency of LOH at 8p23.2, 8p23.1, 8p22, and 8p21 with at least 1 marker was 6% (1 of 16), 52% (16 of 31), 47% (15 of 32), and 13% (4 of 32) for liver cancer cases respectively (Table 2). A similar result was obtained in the lesion-to-lesion comparison (data not shown). In contrast, no allelic loss at any markers on 8p was detected in the background liver tissue. The average frequency of LOH at 8p23.2-21 was 22% (58 of 264) in informative cases. We found that LOH at the 8p23.1 and 8p22 loci was significantly higher than the average in HCC cases (P = 0.0008, and P = 0.004, respectively). But allelic loss at 8p23.2 and 8p21, the loci on either side of the 8p23.1-22 region, tended to be lower than the average. On the other hand, no allelic loss (0 of 52 lesions) was detected at any informative markers on 8p23.2-21 in the surrounding liver tissues. Moreover, allelic loss at D8S277, D8S503, D8S1130, D8S552, D8S1109, D8S254, and D8S258 was 25%, 42%, 39%, 43%, 24%, 43% and 50%, respectively, significantly higher than that elsewhere and the average frequency at 8p.

Table 2 LOH status for the 8p23.2, 8p23.1, and 8p22 in hepatocellular carcinoma.
CaseAgeSexSt/MtGradingEtiologyD8S264D8S2628p23.2D8S1742D8S277D8S1819D8S503D8S1130D8S552D8S11098p23.1D8S254D8S261D8S258D8S2988p22D8S1752D8S1734D8S14458p218p23.2-21
1260MMtMDAlcoholicninininininininini
1164MStMDCH(C)+, LCninininininini
142MStPDCH(B)+nininininininini
259MStMDCH(-)nininininini
2769MMtPDCH(C)+nininininininini
2658MStMDCH(C)+, LCnininini
1531FMtMDCH(C)+ninininininininininininini
2973MStWDCH(C)+ninininininininini
672MStMDCH(C)+ninininininininini
2065MStWDAlcoholic, LCnini
874MMtMDCH(-)nininininininini
759MMtWDCH(B)+, (C)+ninininini
1950MMtMDCH(B)+, LCninini
2858MMtMDCH(B)+ninininininini
551MMtMDCH(B)+nininininininininininini
1071FMtMDCH(C)+, LCninininininini
457MMtMDCH(C)+, LCnini
1374MMtMDCH(-)nininininininininininininini
1851MStWDCH(B)+, LCnininininininininini
1654MMtMDAlcoholic, LCnininininininininini
2571MStMDCH(B)+, (C)+nininininininininininini
3056MStMDCH(C)+ninininininininini
957MStWDCH(C)+nininininininininininini
351MStMDCH(B)+nininininininini
3254FStMDCH(B)+, LCninini
2167MStWDCH(C)+, LCninininininininininininini
3376FStWDCH(C)+, LCnininininini
2371MMtMDCH(-)ninininininininininininini
2265MMtMDCH(C)+ninininininininininini
3165FMtMDCH(C)+, LCninininininininininini
1737FMtMDCH(B)+, LCnininininininininininininininini
2460MMtMDCH(-), LCnininininininini
LOH ●0113425934161018215321420
Informative (32/33)8131617161212237173123101613322323313232
LOH/Informative (58/264 = 22%)0%8%6%a18%25%17%42%39%43%24%52%b43%10%50%15%47%c13%9%3%13%d63%e

Correlations between LOH frequency and clinicopathological variables are summarized in Table 3. To determine whether allelic loss at 8p was associated with clinicopathological characteristics and reveal its biological role in the initiation and/or progression of tumors, we compared the frequency of LOH based on almost all of the clinicopathological findings. Corresponding to the result described above, the LOH frequency tended to be higher at 8p23.1 and 8p22 loci than at 8p23.2 and 8p21 loci for all clinicopathological findings, but no significant difference in LOH frequency was found between the liver cancer positive or negative for malignant factors. In other words, no association was detected between the deletion of 8p23.1-22 and subsequent progression of the tumors.

Table 3 Distribution of LOH frequency at 8p in hepatocellular carcinoma cases by clinicopathological variables.
ClinicopathologicalVariablesD8S264D8S2628p23.2D8S1742D8S277D8S1819D8S503D8S1130D8S552D8S11098p23.1D8S254D8S261D8S258D8S2988p22D8S1752D8S1734D8S14458p218p23.2-21
Tumor size (mm)
> 500/40/40/5 (0%)0/61/50/62/44/120/13/810/14 (71%)4/100/53/71/66/13 (46%)0/100/100/150/15 (0%)10/15 (67%)
< 500/31/71/8 (13%)3/113/112/63/75/113/61/96/17 (35%)6/131/75/91/79/16 (56%)3/112/141/154/15 (27%)10/17 (59%)
Tumor number
St0/20/30/5 (0%)1/91/81/52/63/121/33/106/15 (41%)9/181/64/71/74/13 (31%)3/202/181/244/24 (17%)17/24 (71%)
Mt0/51/101/10 (10%)2/73/81/63/66/112/41/710/16 (63%)1/40/44/91/65/13 (38%)0/20/50/70/7 (0%)2/7 (29%)
Growth Pattern
Eg0/81/131/15 (7%)3/164/132/114/119/223/73/1514/28 (50%)8/201/87/142/1313/26 (50%)3/202/211/294/29 (14%)18/29 (62%)
Ig0/10/10/1 (0%)0/10/30/21/10/10/01/22/5 (40%)2/20/21/20/02/2 (100%)0/20/20/20/2 (0%)2/2 (100%)
Formation of capsule
Fc-0/61/81/10 (10%)2/31/41/42/34/73/42/55/6 (83%)3/41/33/30/35/5 (100%)2/51/50/52/5 (40%)5/5 (100%)
Fc+0/20/60/6 (0%)1/143/121/83/95/170/32/1211/25 (44%)7/180/75/132/1010/23 (43%)1/181/181/262/26 (8%)15/26 (58%)
Infiltration to capsule
Fc-Inf-0/61/81/10 (10%)1/51/70/73/53/80/42/87/11 (64%)3/100/54/90/37/15 (47%)1/101/120/151/15 (7%)10/15 (67%)
Fc-Inf+0/10/30/3 (0%)1/81/30/21/43/100/01/55/13 (38%)5/90/33/52/76/11 (55%)1/100/80/131/13 (8%)7/13 (54%)
Septal formation
Sf-0/00/30/3 (0%)1/72/61/73/53/81/42/57/13 (54%)5/90/55/91/47/15 (47%)1/120/120/161/16 (6%)9/16 (56%)
Sf+0/61/91/10 (10%)2/81/50/31/43/101/12/75/12 (42%)4/100/33/61/67/11 (64%)2/91/90/122/12 (17%)8/12 (67%)
Grading
WD0/30/30/4 (0%)1/42/42/41/24/61/41/24/8 (50%)3/61/23/51/53/7 (43%)1/71/71/72/7 (29%)4/7 (57%)
MD1/70/91/13 (8%)2/132/121/94/125/171/123/611/21 (52%)6/131/85/111/1310/18 (56%)2/121/130/212/21 (10%)13/21 (62%)
PD0/00/10/1 (0%)0/10/30/10/11/32/30/12/3 (67%)1/21/30/10/01/2 (50%)0/20/20/20/2 (0%)2/2 (100%)
pT
pT10/10/20/2 (0%)0/20/10/10/11/20/30/20/5 (0%)2/60/12/31/23/6 (50%)0/60/60/60/6 (0%)3/6 (50%)
pT21/70/71/10 (10%)2/61/71/34/64/52/53/37/11 (64%)5/81/45/70/47/11 (64%)2/81/90/112/11 (18%)8/11 (73%)
pT30/20/20/3 (0%)1/42/21/30/23/81/50/15/8 (63%)2/40/10/21/42/5 (40%)1/51/51/82/8 (25%)5/8 (63%)
pT40/00/00/0 (0%)0/00/10/10/00/11/10/01/1 (100%)1/10/20/00/01/2 (50%)0/10/10/20/2 (0%)1/2 (50%)
pN
pN-1/80/101/12 (8%)3/73/72/43/56/91/80/15/12 (42%)4/90/06/72/78/13 (62%)3/112/101/134/13 (31%)9/13 (69%)
pNx0/00/30/3 (0%)0/61/50/41/42/92/61/56/12 (50%)2/40/61/50/12/4 (50%)0/50/50/70/7 (0%)4/7 (57%)
pM
pM-1/60/111/13 (8%)2/71/51/23/53/103/82/46/14 (43%)3/71/55/91/66/11 (55%)2/101/110/132/13 (15%)7/13 (54%)
pMx0/00/00/0 (0%)0/02/30/20/12/20/21/13/4 (75%)5/60/10/10/05/7 (71%)1/50/50/81/8 (13%)7/8 (88%)
Vascular infiltration
V-0/71/101/13 (8%)2/103/101/84/96/132/62/99/20 (45%)6/150/57/130/711/20 (55%)2/162/181/213/21 (14%)14/21 (67%)
V+1/70/21/9 (11%)1/71/61/41/33/101/12/87/11 (64%)4/61/51/32/64/7 (57%)1/60/50/91/9 (11%)5/9 (56%)
Bile duct infiltration
B-0/101/131/17 (6%)3/184/152/114/1310/243/93/1715/28 (54%)7/182/98/152/1211/24 (46%)2/192/201/273/27 (11%)16/27 (59%)
B+0/10/10/2 (0%)0/30/31/41/30/41/31/43/4 (75%)3/51/50/10/44/5 (80%)1/40/40/51/5 (20%)4/5 (80%)
Liver cirrhosis
LC-0/20/60/6 (0%)1/82/71/61/47/141/13/811/18 (61%)6/110/44/72/89/16 (56%)1/101/131/182/18 (11%)12/18 (67%)
LC+0/51/51/7 (14%)2/92/91/64/82/92/61/95/13 (38%)4/101/64/90/56/13 (46%)2/111/110/142/14 (14%)8/14 (57%)
Chronic hepatitis
CH-0/10/30/4 (0%)2/32/31/11/23/71/12/44/8 (50%)4/61/32/51/35/7 (71%)2/60/50/82/8 (25%)6/8 (75%)
CH+0/61/71/9 (11%)1/132/131/114/96/162/62/1312/23 (52%)6/170/76/111/1010/22 (45%)1/172/191/242/24 (8%)14/24 (58%)

The distribution of LOH frequency based on the fibrosis (F) of background liver tissues, which is usually thought to be associated with hepatocarcinogenesis, was also analyzed. The frequency of LOH at 8p23.1 or 8p22 in F1, F2, F3, and F4 was 75% (3 of 4), 78% (7 of 9), 20% (1 of 5), and 38% (5 of 13), or 100% (2 of 2), 56% (5 of 9), 40% (2 of 5), and 46% (6 of 13), respectively. No statistically significant difference in LOH frequency was found on the basis of the fibrosis staging at 8p. Allelic loss at 8p even tended to be slightly more frequent in cases of tumor with earlier-stage fibrosis than in cases with advanced stage fibrosis of the background liver tissues.

DISCUSSION

Previous studies of LOH have reported that allelic loss of 8p is the most frequent chromosomal alteration in a variety of human cancers and have suggested that one or several tumor suppressor genes (TSGs) may lie within the short arm of chromosome 8[16-19]. To further identify the precise location of the putative TSGs that might potentially be involved in the tumorigenesis of HCC, we performed a high-density LOH study of HCC at 8p using recently developed microsatellite markers. Only 16 of 61 (less than 30%) were identified as informative for Japanese patients. Furthermore, among the informative markers, the informative cases for all specimens were usually lower (from 20% to 70%) for Japanese than for Westerners. The samegeneral tendency has been found in various other types of cancer, possibly because Japan is not multiracial like Western countries. This has led us to suggest that using this characteristic might be more efficient for identifying candidate regions of deletion at 8p.

In this study, LOH at 8p was detected in 56% of informative cases of HCC. However, no allelic loss was found in corresponding hepatocytes including 18 lesions of morphogenetic non-tumor tissues and 14 lesions of cirrhotic liver tissues at any markers, the latter usually considered a premalignant liver lesion. Our result suggests that allelic loss at 8p is an important event in the initiation or promotion of HCC.

Furthermore, among the informative regions 8p23.2, 8p23.1, 8p22, and 8p21, allelic loss was significantly more frequent at 8p23.1 and 8p22 than at 8p23.2 and 8p21 on both sides of the loci. Several minimal regions adjacent to frequently deleted markers were also identified, such as D8S277, D8S503, D8S1130, and D8S552 at 8p23.1, and D8S254 and D8S258 at 8p22. On the basis of the minimal regions of overlapping deletions at 8p, we identified two sites, 8p23.1 and 8p22, possibly containing TSGs involved in human liver carcinogenesis. That is to say, the commonly deleted regions were restricted to 8p23.1-22 suggesting that the key genes exist in two distinct regions that might be closely related to the carcinogenesis of HCC. Our results are consistent with previously reported patterns of molecular change in HCC and other epithelial tumors. No statistically significant differences were detected in the candidate regions 8p23.1 and 8p22 between the frequency of LOH and any clinicopathologic characteristics, including etiological factors considered to contribute to tumorigenesis, and malignant factors usually important to the subsequent progression of tumors. These results led us to the hypothesis that loss of 8p is not essential for the subsequent development or progression of HCC.

Moreover, with respect to the results of allelotyping, several genes, such as angiopintin 2 (ANGPT2), AGPAT5, LOC648814, DEFB 137 and DEFB 136, LONRF1, and FLJ36980, which were adjacent to the candidate markers D8S277, D8S503, D8S1130, D8S552, and D8S1109 at 8p23.1, respectively, were analyzed for somatic mutations or expression by single nucleotide polymorphisms (SSCPs) and the reverse transcription polymerase chain reaction (RT-PCR) methods. However, no significant mutation or absence of expression of these adjacent genes was found (data not shown), indicating that alterations of those genes may not be closely related to the carcinogenesis[16-19,26]. Several new candidate cancer-susceptibility genes at 8p22, such as deleted in breast cancer 2 (DBC2), leucine zipper tumor suppressor 1 (LZTS1), and deleted in liver cancer 1 (DLC1), and mitochondrial tumor suppressor 1 (MTUS1) have been cloned[27-30]. We have analyzed these genes in the same HCC samples, but a somatic mutation or absence of expression of these candidate genes is rare in Japanese patients (data not shown), indicating that these well-known candidate genes are not the main targets of the observed LOH at 8p22. Although no significant genetic alterations were detected in HCC in the present study, it could not be denied that they had already had some epigenetic change during the pre-cancer stage or earlier in the carcinogenesis. Although detailed data have not been published, the present results strongly suggest that other unknown genes in the region 8p22-23.1 play an important role in HCC. Further studies are needed to identify critical oncogenes or TSGs, including those in 8p22-23.1. Our results should be useful for identifying the targets of deletion at 8p.

ACKNOWLEDGMENTS

We thank Miss Kana Tamura and Ms. Michiko Kasai for their help in collecting samples, Mrs. Misako Shirai and Mrs. Mamiko Owada for technique help, and Miss Michiko Takagi for photographic help.

Footnotes

S- Editor Liu Y L- Editor Zhu LH E- Editor Lu W

References
1.  Parkin DM, Pisani P, Ferlay J. Estimates of the worldwide incidence of 25 major cancers in 1990. Int J Cancer. 1999;80:827-841.  [PubMed]  [DOI]  [Cited in This Article: ]  [Cited by in F6Publishing: 20]  [Reference Citation Analysis (0)]
2.  Pisani P, Bray F, Parkin DM. Estimates of the world-wide prevalence of cancer for 25 sites in the adult population. Int J Cancer. 2002;97:72-81.  [PubMed]  [DOI]  [Cited in This Article: ]  [Cited by in Crossref: 491]  [Cited by in F6Publishing: 456]  [Article Influence: 20.7]  [Reference Citation Analysis (0)]
3.  Bosch FX, Ribes J, Díaz M, Cléries R. Primary liver cancer: worldwide incidence and trends. Gastroenterology. 2004;127:S5-S16.  [PubMed]  [DOI]  [Cited in This Article: ]  [Cited by in Crossref: 1799]  [Cited by in F6Publishing: 1773]  [Article Influence: 88.7]  [Reference Citation Analysis (0)]
4.  Bruix J, Boix L, Sala M, Llovet JM. Focus on hepatocellular carcinoma. Cancer Cell. 2004;5:215-219.  [PubMed]  [DOI]  [Cited in This Article: ]  [Cited by in Crossref: 443]  [Cited by in F6Publishing: 468]  [Article Influence: 23.4]  [Reference Citation Analysis (0)]
5.  Feitelson MA, Sun B, Satiroglu Tufan NL, Liu J, Pan J, Lian Z. Genetic mechanisms of hepatocarcinogenesis. Oncogene. 2002;21:2593-2604.  [PubMed]  [DOI]  [Cited in This Article: ]  [Cited by in Crossref: 246]  [Cited by in F6Publishing: 234]  [Article Influence: 10.6]  [Reference Citation Analysis (0)]
6.  Thorgeirsson SS, Grisham JW. Molecular pathogenesis of human hepatocellular carcinoma. Nat Genet. 2002;31:339-346.  [PubMed]  [DOI]  [Cited in This Article: ]  [Cited by in Crossref: 1097]  [Cited by in F6Publishing: 1075]  [Article Influence: 48.9]  [Reference Citation Analysis (0)]
7.  Minister's Secretariat, Ministry of Health, Labor and Welfare, Statistics and Information Dept, Vital Statistics of Japan. Age-adjusted death rates of malignant neoplasms by site, sex and calendar year (1970-2001). 2001;.  [PubMed]  [DOI]  [Cited in This Article: ]
8.  Ng IO, Guan XY, Poon RT, Fan ST, Lee JM. Determination of the molecular relationship between multiple tumour nodules in hepatocellular carcinoma differentiates multicentric origin from intrahepatic metastasis. J Pathol. 2003;199:345-353.  [PubMed]  [DOI]  [Cited in This Article: ]  [Cited by in Crossref: 104]  [Cited by in F6Publishing: 113]  [Article Influence: 5.4]  [Reference Citation Analysis (0)]
9.  Maggioni M, Coggi G, Cassani B, Bianchi P, Romagnoli S, Mandelli A, Borzio M, Colombo P, Roncalli M. Molecular changes in hepatocellular dysplastic nodules on microdissected liver biopsies. Hepatology. 2000;32:942-946.  [PubMed]  [DOI]  [Cited in This Article: ]  [Cited by in Crossref: 57]  [Cited by in F6Publishing: 52]  [Article Influence: 2.2]  [Reference Citation Analysis (0)]
10.  Vogelstein B, Fearon ER, Hamilton SR, Kern SE, Preisinger AC, Leppert M, Nakamura Y, White R, Smits AM, Bos JL. Genetic alterations during colorectal-tumor development. N Engl J Med. 1988;319:525-532.  [PubMed]  [DOI]  [Cited in This Article: ]  [Cited by in Crossref: 4616]  [Cited by in F6Publishing: 4391]  [Article Influence: 122.0]  [Reference Citation Analysis (0)]
11.  Gisin J, Perren A, Bawohl M, Jochum W. Rare allelic imbalances, but no mutations of the PRDX1 gene in human hepatocellular carcinomas. J Clin Pathol. 2005;58:1229-1231.  [PubMed]  [DOI]  [Cited in This Article: ]  [Cited by in Crossref: 4]  [Cited by in F6Publishing: 5]  [Article Influence: 0.3]  [Reference Citation Analysis (0)]
12.  Mori T, Nomoto S, Koshikawa K, Fujii T, Sakai M, Nishikawa Y, Inoue S, Takeda S, Kaneko T, Nakao A. Decreased expression and frequent allelic inactivation of the RUNX3 gene at 1p36 in human hepatocellular carcinoma. Liver Int. 2005;25:380-388.  [PubMed]  [DOI]  [Cited in This Article: ]  [Cited by in Crossref: 52]  [Cited by in F6Publishing: 58]  [Article Influence: 3.1]  [Reference Citation Analysis (0)]
13.  Tischoff I, Markwarth A, Witzigmann H, Uhlmann D, Hauss J, Mirmohammadsadegh A, Wittekind C, Hengge UR, Tannapfel A. Allele loss and epigenetic inactivation of 3p21.3 in malignant liver tumors. Int J Cancer. 2005;115:684-689.  [PubMed]  [DOI]  [Cited in This Article: ]  [Cited by in Crossref: 64]  [Cited by in F6Publishing: 72]  [Article Influence: 3.8]  [Reference Citation Analysis (0)]
14.  Bando K, Nagai H, Matsumoto S, Koyama M, Kawamura N, Onda M, Emi M. Identification of a 1-cM region of common deletion on 4q35 associated with progression of hepatocellular carcinoma. Genes Chromosomes Cancer. 1999;25:284-289.  [PubMed]  [DOI]  [Cited in This Article: ]  [Cited by in F6Publishing: 1]  [Reference Citation Analysis (0)]
15.  Okabe H, Ikai I, Matsuo K, Satoh S, Momoi H, Kamikawa T, Katsura N, Nishitai R, Takeyama O, Fukumoto M. Comprehensive allelotype study of hepatocellular carcinoma: potential differences in pathways to hepatocellular carcinoma between hepatitis B virus-positive and -negative tumors. Hepatology. 2000;31:1073-1079.  [PubMed]  [DOI]  [Cited in This Article: ]  [Cited by in Crossref: 74]  [Cited by in F6Publishing: 76]  [Article Influence: 3.2]  [Reference Citation Analysis (0)]
16.  Kahng YS, Lee YS, Kim BK, Park WS, Lee JY, Kang CS. Loss of heterozygosity of chromosome 8p and 11p in the dysplastic nodule and hepatocellular carcinoma. J Gastroenterol Hepatol. 2003;18:430-436.  [PubMed]  [DOI]  [Cited in This Article: ]  [Cited by in Crossref: 32]  [Cited by in F6Publishing: 27]  [Article Influence: 1.3]  [Reference Citation Analysis (0)]
17.  Chan KL, Lee JM, Guan XY, Fan ST, Ng IO. High-density allelotyping of chromosome 8p in hepatocellular carcinoma and clinicopathologic correlation. Cancer. 2002;94:3179-3185.  [PubMed]  [DOI]  [Cited in This Article: ]  [Cited by in Crossref: 38]  [Cited by in F6Publishing: 37]  [Article Influence: 1.7]  [Reference Citation Analysis (0)]
18.  Pineau P, Nagai H, Prigent S, Wei Y, Gyapay G, Weissenbach J, Tiollais P, Buendia MA, Dejean A. Identification of three distinct regions of allelic deletions on the short arm of chromosome 8 in hepatocellular carcinoma. Oncogene. 1999;18:3127-3134.  [PubMed]  [DOI]  [Cited in This Article: ]  [Cited by in Crossref: 83]  [Cited by in F6Publishing: 81]  [Article Influence: 3.2]  [Reference Citation Analysis (0)]
19.  Piao Z, Park C, Park JH, Kim H. Allelotype analysis of hepatocellular carcinoma. Int J Cancer. 1998;75:29-33.  [PubMed]  [DOI]  [Cited in This Article: ]  [Cited by in F6Publishing: 3]  [Reference Citation Analysis (0)]
20.  Anzola M, Cuevas N, Lopez-Martinez M, Martinez de Pancorbo M, Burgos JJ. p16INK4A gene alterations are not a prognostic indicator for survival in patients with hepatocellular carcinoma undergoing curative hepatectomy. J Gastroenterol Hepatol. 2004;19:397-405.  [PubMed]  [DOI]  [Cited in This Article: ]  [Cited by in Crossref: 14]  [Cited by in F6Publishing: 17]  [Article Influence: 0.9]  [Reference Citation Analysis (0)]
21.  Kremer-Tal S, Reeves HL, Narla G, Thung SN, Schwartz M, Difeo A, Katz A, Bruix J, Bioulac-Sage P, Martignetti JA. Frequent inactivation of the tumor suppressor Kruppel-like factor 6 (KLF6) in hepatocellular carcinoma. Hepatology. 2004;40:1047-1052.  [PubMed]  [DOI]  [Cited in This Article: ]  [Cited by in Crossref: 114]  [Cited by in F6Publishing: 119]  [Article Influence: 6.0]  [Reference Citation Analysis (0)]
22.  Chen CF, Yeh SH, Chen DS, Chen PJ, Jou YS. Molecular genetic evidence supporting a novel human hepatocellular carcinoma tumor suppressor locus at 13q12.11. Genes Chromosomes Cancer. 2005;44:320-328.  [PubMed]  [DOI]  [Cited in This Article: ]  [Cited by in Crossref: 25]  [Cited by in F6Publishing: 27]  [Article Influence: 1.4]  [Reference Citation Analysis (0)]
23.  Zhu GN, Zuo L, Zhou Q, Zhang SM, Zhu HQ, Gui SY, Wang Y. Loss of heterozygosity on chromosome 10q22-10q23 and 22q11.2-22q12.1 and p53 gene in primary hepatocellular carcinoma. World J Gastroenterol. 2004;10:1975-1978.  [PubMed]  [DOI]  [Cited in This Article: ]
24.  Nishida N, Fukuda Y, Komeda T, Ito T, Nishimura T, Minata M, Kuno M, Katsuma H, Ikai I, Yamaoka Y. Prognostic impact of multiple allelic losses on metastatic recurrence in hepatocellular carcinoma after curative resection. Oncology. 2002;62:141-148.  [PubMed]  [DOI]  [Cited in This Article: ]  [Cited by in Crossref: 16]  [Cited by in F6Publishing: 19]  [Article Influence: 0.9]  [Reference Citation Analysis (0)]
25.  Yeh SH, Chen PJ, Shau WY, Chen YW, Lee PH, Chen JT, Chen DS. Chromosomal allelic imbalance evolving from liver cirrhosis to hepatocellular carcinoma. Gastroenterology. 2001;121:699-709.  [PubMed]  [DOI]  [Cited in This Article: ]  [Cited by in Crossref: 76]  [Cited by in F6Publishing: 78]  [Article Influence: 3.4]  [Reference Citation Analysis (0)]
26.  Lu W, Takahashi H, Furusato B, Maekawa S, Ikegami M, Sudo A, Egawa S, Hano H. Allelotyping analysis at chromosome arm 8p of high-grade prostatic intraepithelial neoplasia and incidental, latent, and clinical prostate cancers. Genes Chromosomes Cancer. 2006;45:509-515.  [PubMed]  [DOI]  [Cited in This Article: ]  [Cited by in Crossref: 15]  [Cited by in F6Publishing: 17]  [Article Influence: 0.9]  [Reference Citation Analysis (0)]
27.  Knowles MA, Aveyard JS, Taylor CF, Harnden P, Bass S. Mutation analysis of the 8p candidate tumour suppressor genes DBC2 (RHOBTB2) and LZTS1 in bladder cancer. Cancer Lett. 2005;225:121-130.  [PubMed]  [DOI]  [Cited in This Article: ]  [Cited by in Crossref: 58]  [Cited by in F6Publishing: 57]  [Article Influence: 2.9]  [Reference Citation Analysis (0)]
28.  Seng TJ, Low JS, Li H, Cui Y, Goh HK, Wong ML, Srivastava G, Sidransky D, Califano J, Steenbergen RD. The major 8p22 tumor suppressor DLC1 is frequently silenced by methylation in both endemic and sporadic nasopharyngeal, esophageal, and cervical carcinomas, and inhibits tumor cell colony formation. Oncogene. 2007;26:934-944.  [PubMed]  [DOI]  [Cited in This Article: ]  [Cited by in Crossref: 99]  [Cited by in F6Publishing: 106]  [Article Influence: 5.9]  [Reference Citation Analysis (0)]
29.  Di Benedetto M, Pineau P, Nouet S, Berhouet S, Seitz I, Louis S, Dejean A, Couraud PO, Strosberg AD, Stoppa-Lyonnet D. Mutation analysis of the 8p22 candidate tumor suppressor gene ATIP/MTUS1 in hepatocellular carcinoma. Mol Cell Endocrinol. 2006;252:207-215.  [PubMed]  [DOI]  [Cited in This Article: ]  [Cited by in Crossref: 36]  [Cited by in F6Publishing: 37]  [Article Influence: 2.1]  [Reference Citation Analysis (0)]
30.  Di Benedetto M, Bièche I, Deshayes F, Vacher S, Nouet S, Collura V, Seitz I, Louis S, Pineau P, Amsellem-Ouazana D. Structural organization and expression of human MTUS1, a candidate 8p22 tumor suppressor gene encoding a family of angiotensin II AT2 receptor-interacting proteins, ATIP. Gene. 2006;380:127-136.  [PubMed]  [DOI]  [Cited in This Article: ]  [Cited by in Crossref: 70]  [Cited by in F6Publishing: 70]  [Article Influence: 3.9]  [Reference Citation Analysis (0)]