Construction of retroviral vector of p125FAK specific ribozyme genes and its effects on BGC-823 cells

Abstract

AIM: To construct the retroviral vector of p^125FAK specific ribozyme genes and to explore the feasibility of ribozyme in BGC-823 gene therapy in vitro.

METHODS: A hammerhead ribozyme DNA targeting p^125FAK mRNA from nt 1010 to nt 1032 was synthesized and recombinated into the retroviral vector pLXSN forming pLRZXSN recon. Using the lipofectin-mediated DNA transfection technique, pLRZXSN was introduced into BGC-823 cells. The effects of ribozyme on the growth of BGC-823 cells and apoptosis were studied by cell colony assay, flow cytometry (FCM), reverse transcriptase-polymerase chain reaction (RT-PCR), detection of DNA fragmentation and electron microscopy.

RESULTS: The number of BGC-823 cell colonies was inhibited by 56% after the cells were treated for 48 h. The cell proliferation was inhibited effectively by p^125FAK ribozyme and the inhibitory effect depended on the concentration and the time of incubation. The expression of p^125FAK mRNA and protein P¹²⁵ decreased sharply in BGC-823 cells treated with p^125FAK ribozyme. The characteristics of apoptosis, namely sub-G1 peak, DNA fragmentation and morphological changes, were revealed in BGC-823 cells treated with p^125FAK ribozyme.

CONCLUSION: p^125FAK ribozyme decreases p^125FAK gene expression and induces apoptosis of human gastric cancer cells in vitro.

Key Words: Ribozyme, p^125FAK gene, Stomach neoplasm, Apoptosis

INTRODUCTION

p^125FAK is a non-receptor cytoplasm protein tyrosine kinase (PTK) with a molecular weight of 125 ku , which has unique structural and functional characteristics . Focal adhesion kinase (FAK) regulates multiple cellular processes including growth, differentiation, adhesion, motility and apoptosis[1-4]. The high expression of p^125FAK is possibly a part of cell incidents contributing to the invasion and metastasis of tumors[5-7]. Ribozyme (RZ) is defined as a kind of small RNA molecule that has catalytic activity and can inhibit the translation process of mRNA after RZ combines with the complementary sequences of mRNA and incises it[8-11]. In this study, a hammerhead ribozyme DNA targeting p^125FAK mRNA from nt 1010 to nt 1032 was synthesized according to p^125FAK cDNA sequences, and recombinated into the retroviral vector pLXSN forming pLRZXSN recon. Using the lipofectin-mediated DNA transfection technique, pLRZXSN was introduced into BGC-823 cells to study the expression of RZ and its effect on BGC-823 cells.

MATERIALS AND METHODS

Materials

BGC-823 cells were purchased from Shanghai Cytobiology Institute of Chinese Academy of Medical Sciences. E. coli DH-5 were donated by Hematopathy Laboratory of Fujian Medical University. Restriction enzymes (HindIII, pstI, BamHI, XhoI)and T₄DNA ligase, X-gal, ITPG were all from Promega. pBluescript@SK plasmid was from Stratagene. RT-PCR kit was from Promega， Lipofectin ^TM was from Gibco/BRL，p^125FAK（H-1）was from American Santa Cruz. S-P kit and DAB kit were from Maxim Biotechnology and Zymed Lab Inc, respectively.

Design and synthesis of RZ template

GUU triplets of nt 1010 to nt 1032 in p^125FAK cDNA base sequences were used as cleavage sites. Two small nucleotide sequences complementary to the cleavage sites of target RNA were put at the two ends of the conservative core sequence-(the hammerhead structure) to form a typical active incisive secondary structure of RZ as previously described[12]. The two limbs and complementary ribonucleotides of target RNA were all 10 nt. RZ gene consisted of 2 completely complementary trains called trains A and B, consisting of 60 bases respectively. Two cleavage sites and 3 protective bases were synthesized by Shanghai Sangon Technology Corporation. The sequences of RZ gene were 5’CGGACTCATCAGCAAGCTGGATAAGCTTCGT-3’ for train A and 3’GCCTGAGTAGTCGTTCGACCTATTCGAAGCA-5’ for train B.

Constructtion of sequencing vector and DNA sequence analysis

Plasmid extraction, restrictive enzymolysis reaction, ligase coupled reaction, preparation of competent germ, E coli transfection，agarose gel electrophoresis and DNA fragment retrieval were routinely carried out. DNA sequencing was undertaken by Shanghai Sangon Technology Corporation.

Construction of pLRZSN recon

Sequencing of a fragment of 81 bp was carried out with Bam HI and Xho I, retrieved by polyacrylamide gel electrophoresis(PGE), recombinated into pLXSN cleavage sites of Bam HI and XhoI and then labeled as pLRZSN. The pLRZSN from QIAGEN was exactly quantified and sub-packaged for later use.

Transfection of BGC-823 cells

BGC-823 cells in log growth phase were divided into BGC 823 cell blank group, BGC-823 cells + Lipofectin^TM group, BGC-823 cells + pLXSN group and BGC-823 cells + pLRZSN group. Liquor A was obtained by adding 4 μg DNA (pLXSN or pLRZSN) to 100 μL serum-free RPMI1640, while liguor B was obtained by adding 10μL Lipofectin^TM to 90 μL serum-free RPMI1 640. Liguors A and B were mixed after 30 min and stood for 15 min. At the same time, 1×10⁶ BGC-823 cells in log growth phase were washed. After resuspension in 0.8mL serum-free RPMI1640，the mixture of liquors A and B was added into the suspension and incubated at 37 °C in an atmosphere containing 5% CO₂ for 6 h . Four mL RPMI1640 containing 10% serum was added into the suspension and incubated for 48-72 h and then the BGC823 cells were collected.

Colony forming experiment

After incubated for 48 h, the 4 groups of cells were digested in monoplast suspensions and inoculated into 24-well plates (200/well). At the same time, 3 parallel wells were being designed. After being incubation for 7 d, colonies formed when the number of cells was over 50. The number of colonies was calculated under microscope and the colony forming efficiency was determined.

Detection of p^125FAK protein

After being incubated for 48 h, the 4 groups of cells were digested in monoplast suspensions and inoculated onto slides. When the slides were open-air dried and fixed in cold acetone for 10 min,immunochemistry dyeing was carried out by S-P method. Positive cell cytoplasm was buffy, nuclei and negative cells were not stained. p^125FAK positive cell labeling index (PI = p^125FAK positive cell number under one field of vision/1000×100%) was calculated. After being incubated for 48 h, the 4 groups of cells were digested in monoplast suspensions and prepared into specimens. p^125FAK protein was detected by flow cytometry (Bio-Rad, Bryte-HS).

Evaluation of p^125FAK mRNA

Total RNA was extracted from the cells after incubation for 48 h. cDNA synthesis and PCR amplification were performed as previously described[13]. p^125FAK gene nucleotide sequence to be amplified the primers used are listed in Table 1.

Table 1 Primer sequence and fragment length.

Primer	Sequence	Fragment length (bp)	Annealin Temp (°C)
p125FAK	A: 5’TTCTTCTATCAACAGGTGAAG3’	632	55
	B: 5’CTGCGAGGTTCCATTCACCAG3’
β-actin ’	A: 5’GGCATGGGTCAGAAGGATTCC3	500	55
	B: 5’ATGTCACGCACGATTTCCCGC3’

Note: A and B represent the sense and anti-sense primers, respectively.

Detection of apoptosis of BGC-823 cells

After being incubated for 48 h, the 4 groups of cells were digested in monoplast suspensions, poached with PBS, centrifuged and incubated for 30 min in Kenesis50 kit (BioRad) and the DNA contents were analyzed by FCM. The ultra-structure of BGC-823 cells was observed under transmission electron microscope. The 4 groups of cells incubated for 48 h were prepared and photographed. Extraction and electrophoresis of DNA apoptotic fragments were carried out following the directions of apoptotic DNA ladder kit (Roche Corporation).

Statistical analysis

The data were expressed as mean ± SD. The variance analysis and significant difference test were crried out by SPSS 10.0.

RESULTS

Effect of RZ on colony forming efficiency (CFE) of BGC-823 cells

The results of colony forming experiment are summarized in Table 2. RZ could inhibit colony formation of BGC-823 cells (P < 0.05).

Table 2 Effect of RZ on colony formation of BGC-823 cells.

Groups	CFE (%)	CIE (%)
Control group	51.24 ± 6.8a
Liposome group	46.43 ± 8.6a	9.38
Keno-vector group	45.32 ± 5.2a	11.55
Ribozyme group	16.14 ± 3.5a	68.5

^aP < 0.05 vs other groups.

Effect of RZ on expression of BGC-823 p^125FAK protein

After the cells were incubated for 48 h, the expression rate of p^125FAK protein was 88.4% in control group, 79.55% in liposome group, 77.08% in kenovector group, and 46.09% in ribozyme group. A significant difference was found among the 4 groups. The positive number of BGC823 cells expressed in the p^125FAK protein decreased sharply and the intensity of expression also weakened. PI was obviously smaller in RZ group than in other three groups (Figure 1A).

Figure 1 Expression of p^125FAK protein (A) and mRNA (B) in BGC 823 cells M: Marker; lane 1: control; lane 2: liposome; lane 3: keno-vector; lane 4: RZ

Effect of RZ on p^125FAK mRNA expression in BGC 823 cells

PCR product electrophoresis showed 632 bp and 500 bp bands. The fluorescence intensity value of p^125FAK and β-actin was 1.23 in control group, 0.98 in liposome group, 0.92 in keno-vector group, and 0.38 in RZ group, indicating that the level of p^125FAK mRNA in BGC-823 cells decreased sharply than that in other three groups (Figure 1B).

Apoptosis of BGC-823 cells induced by RZ

Apoptotic peak (sub-diploid peak) appeared in RZ group but not in other three groups (Figure 2).

Figure 2 Cell cycle analysis of cells cultivated for 48 h in liposome group (A), keno-vector group (B) and RZ group (C).

Karyopynosis, chromatin margination, complete caryotheca, condensed kytoplasm with deep staining were found in RZ group. Larger karyoplasmic ratio, puffed chromotin, clear plasmosome, and abundant cytoplasm were seen in other three groups. These cells were poorly-differentiated BGC-823 cells which did not undergo apoptosis (Figure 3).

Figure 3 Apoptotic changes of BGC-823 cells in RZ group.

Typical DNA fragments were seen in RZ group but not in other three groups (Figure 4).

Figure 4 DNA fragments of BGC-823 cells in different groups M: 123 bp DNA ladder; lane1: liposome group; lane 2: keno-vector group; lane 3: RZ group for 24 h; lane 4: RZ group for 48 h; lane 5: RZ group for 72 h.

DISCUSSION

Recent studies showed that when malignant cells adhere to extra-cellular matrix (ECM), p^125FAK tyrosine self phosphorylation takes place and its activity increases[14-16]. The precise mechanism of p^125FAK underlying apoptosis is not clear. But when malignant cells spread or migrate , p^125FAK regulates the formation of adhesion plaque or takes part in signal cascade conduction and inhibits apoptosis by informing karyoplasts to that cells are ECM-anchored[17,18]. Anti-sense oligonucleotides of p^125FAK have been used to inhibit the expression of p^125FAK gene in order to induce apoptosis of malignant cells[19,20], but the result is not satisfactory because the number of target RNAs is so larger that complete blocking is impossible and anti-sense oligonucleotides are so easy to be degraded. RZ may solve the above problems. Ribozyme is a small RNA molecule that has catalytic activity. On the one hand, it can combine with complementary sequences of mRNA to block the translation of mRNA. moreover, it can incise mRNA and promote the degradation of mRNA[10,21]. Symons[8] reported that RZ can be used in treatment of viral disease and tumor. RZ genes such as c-erbB-2, P53, Ras, TGF-β, can be used in oncotherapy[22-25]. Qian et al [26] reported that FGFR3 RZ gene could inhibit the growth of myeloma cells and promote their apoptosis. But studies on p^125FAK RZ gene are relatively fewer. In the present study, a hammerhead ribozyme DNA targeting p^125FAK mRNA from nt 1010 to nt 1032 was synthesized according to p^125FAK cDNA sequences, and recombinated into the retroviral vector pLXSN forming pLRZXSN recon. Using the lipofectin-mediated DNA transfection technique, pLRZXSN was introduced into BGC-823 cells to inhibit the growth of BGC-823 cells to observe the typical changes of apoptosis under electron microscope. The results demonstrate that p^125FAK RZ gene is sequence specific and can be used in treatment of gastric carcinoma.