Liu HL, Wang YJ, Guo HT, Wang YM, Liu J, Yu YC. Cryopreservation and gel collagen culture of porcine hepatocytes. World J Gastroenterol 2004; 10(7): 1010-1014 [PMID: 15052684 DOI: 10.3748/wjg.v10.i7.1010]
Corresponding Author of This Article
Dr. Ying-Jie Wang, Research Institute of Infectious Diseases, Southwest Hospital, Third Military Medical University, Chongqing 400038, China. wangyj103@263.net Telephone: +86-23-68754289
Article-Type of This Article
Basic Research
Open-Access Policy of This Article
This article is an open-access article which was selected by an in-house editor and fully peer-reviewed by external reviewers. It is distributed in accordance with the Creative Commons Attribution Non Commercial (CC BY-NC 4.0) license, which permits others to distribute, remix, adapt, build upon this work non-commercially, and license their derivative works on different terms, provided the original work is properly cited and the use is non-commercial. See: http://creativecommons.org/licenses/by-nc/4.0/
Hong-Ling Liu, Ying-Jie Wang, Hai-Tao Guo, Yu-Ming Wang, Jun Liu, Yue-Cheng Yu, Research Institute of Infectious Diseases, Southwest Hospital, Third Military Medical University, Chongqing 400038, China
Hong-Ling Liu, Now in 302 Hospital of the PLA, Beijing 100039, China
ORCID number: $[AuthorORCIDs]
Author contributions: All authors contributed equally to the work.
Supported by the Natural Scientific Foundation of Nation, No. 30027001, and the National Excellent Doctor Special Foundation, No.199947
Correspondence to: Dr. Ying-Jie Wang, Research Institute of Infectious Diseases, Southwest Hospital, Third Military Medical University, Chongqing 400038, China. wangyj103@263.net Telephone: +86-23-68754289
Received: October 27, 2003 Revised: November 6, 2003 Accepted: November 13, 2003 Published online: April 1, 2004
Abstract
AIM: To study the method of cryopreserving porcine hepatocytes and gel collagen culture measure after its cryopreservation.
METHODS: Hepatocytes, isolated from Chinese experimental suckling mini-pigs by two-step perfusion with collagenase using an extra corporeal perfusion apparatus, were cryopreserved with 50 mL/L to 200 mL/L DMSO in liquid nitrogen for 4 mo, then thawed and seeded in 1 or between 2 layers of gel collagen. The expression of porcine albumin message RNA, cellular morphology and content of aspartate aminotransferase (AST) and urea nitrogen (UN) were examined during culture in gel.
RESULTS: Viability of 150 mL/L DMSO group thawed hepatocytes was (83 ± 4)%, but after purification, its viability was (90 ± 5)%, attachment efficiency was (86 ± 7)%, the viability of thawed hepatocytes was near to fresh cells. When the thawed hepatocytes were cultivated in gel collagen with culture medium adding epidermal growth factor, the hepatocytes grew in various administrative levels in mixed collagen gel, and bunchy in the sandwich configuration cultures. For up to 10 days’ culture, the typical cellular morphological characteristics of cultivated hepatocytes could be observed. The leakage of AST was lower during culture in gel than that in common culture. At the same time, the UN synthesized by cells cultivated in mixed gel collagen was higher than that in other groups.
CONCLUSION: Storage in liquid nitrogen can long keep hepatocytes’ activities, the concentration of 150 mL/L DMSO is fit for porcine hepatocytes’ cryopreservation. Thawed hepatocytes can be cultivated with collagenous matrix, which provides an environment that more closely resembles that in vivo and maintain the expression of certain liver-specific function of hepatocytes.
Key Words: $[Keywords]
Citation: Liu HL, Wang YJ, Guo HT, Wang YM, Liu J, Yu YC. Cryopreservation and gel collagen culture of porcine hepatocytes. World J Gastroenterol 2004; 10(7): 1010-1014
Bioartificial liver support systems (BALSS), which employ freshly isolated primary hepatocytes, present severe logistic difficulties in the continuous supply of hepatocytes[1-3]. Stored frozen hepatocytes that are thawed as required would solve this problem. Now, storing hepatocytes in liquid nitrogen was an important method to keep its biological abilities, suitable preserving measure can offer high vigorous hepatocytes for several researches. With the further development of related subjects, long-term preservation methods and active architecture of hepatocytes were needed badly to meet the immediate requirement of bioartificial liver and correlated researches[4-7]. Cryopreservation of hepatocytes is essential for the emergent treatment of acute liver failure. Morsiani et al[8-13] reported the clinical use of such thawed cells. These clinical reports certainly reflect the progress made to date in the isolation and handling of hepatocytes, and it is hoped this will lead to a wider use of cellular therapies in liver diseases.
In order to find a suitable cryopreservation and culture measure, hepatocytes from newly born Chinese experimental mini-pigs were cryopreserved in -196 °C for 4 mo, then thawed hepatocytes were cultivated with mixed gel or sandwich gel collagen, and their morphology and biological functions were compared. So this study was to develop a cryopreservation protocol for long-time preparation of porcine hepatocytes, and to determine an optimal purification procedure and culture methods for thawed hepatocytes. At last it could provide important experimental data for the research of bioartificial liver and hepatocytes transplantation.
MATERIALS AND METHODS
Isolation of porcine hepatocytes
Pig hepatocytes were harvested from newly born Chinese experimental mini-pigs (Experimental Animal Center, Third Military Medical University) using the two-step collagenase perfusion method that was modified from the original methods developed by Seglen et al[4,20-22]. Briefly, the animals were anesthetized with barbital (30 mg/kg, b.w, intraperitoneally) and their livers were removed. The liver was first perfused in vitro via the portal vein with warmed (37 °C) Ca2+ and Mg2+ free Hanks balanced salt solution at a flow rate of 20-30 mL/min for 10-15 mL/min, and then perfused with 0.5 g/L collagenase (Sigma, Type IV) in the same solution supplemented with 5 mM CaCl2 and 50 mM HEPES. The reperfusion with collagenase solution lasted 20 min at a rate of 20 mL/min at 37 °C. After 10 min of incubation (37 °C) with gentle shaking, the cells suspension was filtered and centrifuged at 50 g, 3 min for 3 times. The viability of the isolated liver cells was determined using standard trypan blue exclusion, ranged from 89% to 98%[14-18].
Cryopreservation of porcine hepatocytes
Isolated hepatocytes were slowly resuspended and gently mixed at 5 × 109cells/L concentration in different cyropreserving solution which consists of 200 mL/L fetal bovine serum (FBS) and 50 mL/L, 100 mL/L, 150 mL/L or 200 mL/L dimethyl sulphoxide (DMSO, Sigma, America), then placed hepatocytes in 1 mL freezing tube (AXYGEN, America), tagged and put into isopropanol. The concrete freezing procedure was: put in room temperature for 15 min; 4 °C for 20 min; -20 °C for 30 min; and stayed overnight at -80 °C, at last, liquid nitrogen for long-term preservation[7,19-23].
Thawing and removal of DMSO
Four months later, the vials were removed from liquid nitrogen and rapidly thawed by immersion in a 37 °C water bath. Immediately after thawing, dimethyl sulfoxide was removed by successive dilutions in 50 mL tubes, 20 mL of Leibowitz-15 medium containing 100 mL/L FBS was gently added to 1.0 mL of cell suspension at 3 min of intervals. The cells were washed three times by centrifugation for 3 minutes at 30 g and 4 °C to remove cryoprotectant. Then hepatocytes pellet was resuspended in L-15 medium with 100 mL/L FBS. Cell viability was estimated by trypan blue dye exclusion. 1 × 106 thawed hepatocytes were centrifuged at 1000 rpm for 10 min, the supernatants of medium discarded, pellet cells fixed by 30 mL/L glutaral and 10 mL/L OsO4etc, and hepatocytes’ ultrastructure was observed through transmission electron microscope[24,25].
Percoll purification of thawed hepatocytes
Working Percoll solution I was prepared by adding 1 part of 10 concentrated D-phosphate-buffered saline into 9 parts of Percoll. Then working Percoll solution II was consisted of 30 mL working Percoll solution I and phosphate-buffered saline. Hepatocytes purification was made by a procedure: to 10 mL of cell suspension, 25 mL of working Percoll solution II were added. The cells pellet was collected by centrifugation at 500 g during 3 min, resuspended, and purified hepatocytes were washed 3 times by centrifugation for 3 min at 30 g and 4 °C.
Common, mixed collagen gel and sandwich configuration culture of thawed hepatocytes
Then hepatocytes were inoculated at 106 cell/ bottle in L-15 medium added by 100 mL/L FBS, 10 μl/L glucagons, 200 U/L insulin and 20 ng/L epidermal growth factor (Sigma), as a control group and the medium was changed every day. The morphologies of hepatocytes were observed under inverted microscope, supernatants of culture cells was stored at -20 °C for examination. Viability of cells was determined using standard trypan blue exclusion measure.
The collagen solution was prepared just before its use by mixing three parts of collagen type VII (Sigma) in one part of 4 × Dulbecco’s modified Eagle’s medium (Gibco, America) without bicarbonate (pH 7.4), adjusting its pH to 7.20 with 1N NaOH. One million cells were mixed with 2 mL collagen solution and incubated in T-flasks (25cm2) at 37 °C. When the mixed collagen matrix was fixed in an hour, the gel was washed slowly and medium was added, and hepatocytes were incubated at 37 °C with 100 mL/L CO2 900 mL/L humidity. The methods of culture and observation were the same to the control group[26,27].
When thawed hepatocytes were cultivated in sandwich configuration, the collagen solution was prepared just as before, then T-flasks were coated with it and incubated one hour at 37 °C. One million cells were cultivated with L-15 medium. Nonattached hepatocytes were washed after one hour; second layer of collagen solution was spread to sandwich the hepatocytes after 24 h. Thirty minutes later, sandwich configuration hepatocytes were formed[28-30], and the methods of culture and observation were just performed as before.
Expression of porcine hepatocytes albumin message RNA
When hepatocytes were cultivated for one week, its total RNA were distillated by Tripure isolated reagent (the gel cultured hepatocytes were digested with 0.5 g/L pancreatin before distillated). The sequences of primers are designed in Table 1. “House-keeping gene” glyceraldehydes-3-phosphate dehydrogenase (G3PDH) gene was kept as inner standard[31].
Table 1 Nucleotide sequences of primers and band sizes.
Primers
Sequences (5’-3’)
Band sizes
mRNA
sense
CTTATTCCAGGGGTCTGTTTC
324 bp
antisense
TCGTTTCTCTCAGGCTCTTCT
G3PDH
sense
CATCATCCCTGCTTCTACCC
160 bp
antisense
CCTGCTTCACCACTTTCTTG
RNA was reverse transcribed using a one-step RT-PCR kit (Promga, America). For RT-PCR amplification, the standard RT-PCR program of one cycle of 48 °C for 45 min and 94 °C for 4 min, 35 cycles of 95 °C for 1 min, 55 °C for 1 min, and 72 °C for 1 min and one cycle of 72 °C for 7 min were applied. The products of RT-PCR were electrophoresised on 15 g/L agarose gel, and figures were gained on Gel-DocTM2000 (BIO-RAD, America). The densities of these straps were scanned, and the odds of every group’s band/ corresponding G3PDH strap were seen as the expression of objective gene.
Aspartate aminotransferase (AST) and urea nitrogen (UN)
The level of AST and UN, in culture supernatants of the control group, mixed gel and sandwich configuration, were detected with biological analysis meter (HITACH. Japan)[32].
Data statistics
The data was analysed by the duplication measurement analysis of variance or one-way analysis of variance on SPSS 11.0 software. Results were expressed on mean±standard deviation (mean ± SD).
RESULTS
Survival rate and attaching efficiency of hepatocytes
Fresh isolated and cryopreserved/purified hepatocytes were assessed for viability and function by trypan blue dye exclusion. The yield of cells was 1.5 to 5 × 109 cells/liver. Cell viability was (91 ± 4)%, and attachment efficiency of viable hepatocytes after 24 h culture was (89 ± 5)%. After cryopreservtion, the viabilities of 50 mL/L, 100 mL/L, 150 mL/L and 200 mL/L DMSO group of hepatocytes were in Table 2. However, when the 150 mL/L DMSO group thawed hepatocytes were purified by Percoll, its viability was (90 ± 5)%, attachment efficiency was (86 ± 7)%. The viability of thawed hepatocytes were near to fresh cells.
Table 2 Viability and 24 hours attaching efficiency of thawed hepatocytes (%).
In this table, we can see the viability of 100 mL/L DMSO group cells were much better than that of 50 mL/L and 100 mL/L DMSO groups (P < 0.05), but there was no significant difference between the group of 150 mL/L DMSO and 200 mL/L DMSO (P > 0.05).
Morphology of thawed hepatocytes
The ultrastructure of thawed hepatocytes in 150 mL/L DMSO group were kept well, number of mitochondria was normal, with slight swellen cristae, rough endoplasmic reticulum decreased, smooth endoplasmic reticulum and golgi apparatus increased, chromatin in cell nucleus distributed normal (Figure 1A).
Thawed hepatocytes of 150 mL/L DMSO group attached to dishes within 4 h (Figure 1B). After 24 hours’ culture, cells appeared polygonal, containing granular cytoplasm with one or two centrally located nuclei. Seven days later, they were more flattened and appeared bigger than 24 h cultured hepatocytes. Morphology and ultrastructure of other groups’ hepatocytes were abnormal, thus the hepatocytes of 150 mL/L group were provided for gel collagen culture.
Figure 1 A: The thawed hepatocytes’ ultrastructure after 4 mo cryopreservation, (TEM, × 4000), B: The morphology of thawed hepatocytes after 4 h culture (PCM, × 200).
Morphology of mixed gelled cultivated pig hepatocytes
The hepatocytes kept their biological characters well after 150 mL/L DMSO cryopreservation. When the thawed hepatocytes were mixed in gel collagen and cultivated with medium adding epidermal growth factor, the hepatocytes grow in various administrative levels in collagen gel. For up to 7 days’ culture, the typical cellular morphological characteristics of hepatocytes could be observed (Figure 2A).
Figure 2 A: Morphology of thawed hepatocytes cultivated in mixed gel for 4 h (PCM, × 200), B: Morphology of hepato-cytes cultivated in sandwich configuration for 24 h (PCM, × 200).
Morphology of sandwich culture pig hepatocytes
Hepatocytes, cultivated for four hours in first layer gel, turned from pellet to polygon. When second layer gel collagen was added, hepatocytes cultured in collagen sandwich configuration had a cuboid, compact, bunchy, and well-defined shape with a classical cobblestone appearance. In the seven-days’ culture period, the hepatocytes maintained their typical morphological characteristics under phase contract microscope (Figure 2B).
Expression of albumin mRNA on thawed porcine hepatocytes
When the control group mixed gel collagen and sandwich configuration porcine hepatocytes were cultivated for seven days, they all kept expression of albumin message RNA using RT-PCR, but the level of mixed gel collagen group was higher than that of other group (P < 0.05), (Figure 3 and Table 3).
Table 3 Change of albumin mRNA expression in culture pig hepatocytes (mean ± SD).
Figure 3 Expression of porcine albumin mRNA on culture hepatocytes after RT-PCR.
M: DNA markers; lanes 1, 2 and 3 are control groups, mixed gel collagen and sandwich configuration.
Release of AST
The level of AST in common culture hepatocytes supernatant was very lower on day 1 to day 3, and ascended to the peak on day 7, which was marked higher than the group of mixed gel collagen or sandwich collagen (P < 0.05). The contents of AST in the group of gel collagen on culture 24 to 48 h were high, but they dropped at day 3 and kept at a lower level (P > 0.05), (Figure 4).
Figure 4 Content of AST on hepatocytes culture medium.
UN in culture supernatant
The levels of urea nitrogen synthesized by hepatocytes in three groups were different and changed. The content in common culture group decreased on day 5, and was lower than that of other groups on culture period (P < 0.05). Mixed gel group’s level was higher than that of the sandwich, but they had no marked difference. (P > 0.05), (Figure 5).
Figure 5 Content of urea nitrogen on hepatocytes culture medium.
DISCUSSION
Hepatocytes cryopreserved in liquid nitrogen were thought as only efficient measure to keep its ability currently[33-36]. Shortage of hepatocytes necessitates the development of improved cryopreservation techniques for long-term storage of hepatocytes to make best use of available hepatocytes. The ultimate goal of any improved cryopreservation protocol is to minimize sudden intracellular formation of ice crystals that could result in ultrastructural damage, and thus maintains cell viability, attachment, and metabolic activity on thawing. Storage time of cryopreserved hepatocytes at temperatures -196 °C may play an important role in the quality of thawed cells. Most of the available protocols use dimethyl sulfoxide in the cryopreservation medium[19,37-39].
Successful cryopreservation of porcine hepatocytes would ensure the accessibility of cells for laboratory use, permit the standardisation of experiments, save lives of animals and lead to continuous supply of hepatocytes in BALSS treatment[28,31]. Therefore, we sought the optimal procedure for cryopreservation of porcine hepatocytes for both laboratory and clinical purposes in this study. The protocol for cryopreservation of hepatocytes included the concentration of 150 mL/L DMSO, 200 mL/L fetal bovine serum and rapid thawing followed by slow dilution of DMSO to avoid osmotic shock. After 4 mo cryopreservation, the thawed cells were shown to have a reasonable level of cell viability, compared to freshly isolated hepatocytes. So the storage condition was proved to be suitable for long-time cryopreservation of pig hepatocytes. Our purification method using D-PBS and Percoll achieved a high cell recovery rate with satisfactory viability and function at high cell concentrations (5 × 109cell /L), facilitating purification of hepatocytes in large quantities. We conclude that frozen/thawed/purified cells can possess satisfactory viability and function. Large-scale cryopreservation of porcine hepatocytes may provide an efficient alternative to freshly isolated porcine hepatocytes[19,40-42].
Proper cryopreservation measure can maintain porcine hepatocytes’ abilities for a long time. However, if the thawed hepatocytes were cultivated in unfit conditions, it would not meet the need of application in clinic and basic research. Therefore, the culture pattern of thawed hepatocytes also appeared very important. Traditional cell culture measure, which was common monolayer attaching incubation, was hard to simulate the circulation that hepatocytes grew in vivo, and were not suitable for BLASS[43]. Collagen was a kind of matrix in common use to fix hepatocytes. Liver cells in vivo assume three-dimension configuration in a liver lobule, and there are complicated contacts among hepatocytes, liver non-parenchyma cells and cell matrix. Matrix is an important part of affecting hepatocytes function. Many researches showed that collagenous matrix could provides an environment that more closely resembles that in vivo and allows to maintain the expression of certain liver-specific function of hepatocytes[44-47]. In this study, the hepatocytes keep their biological characters well after storage in liquid nitrogen for 4 mo. When the thawed hepatocytes were cultivated in gelled collagen with culture medium added by epidermal growth factor, the cells grow in various administrative levels in mixed collagen gel, and bunchy in the collagen sandwich cultures. For up to 10 days’ cultures, the typical cellular polygonal morphological characteristics of culture hepatocytes could be observed, and the bound between hepatocytes appear brightly and clearly; the leakage of aspartate aminotransferase was less and the level of urea nitrogen synthesized by hepatocytes was higher. Through sandwich culture can hold hepatocytes synthesizing and metabolizing abilities, the cultivated hepatocytes was also at monolayer attaching state, and do not have normal three-dimension construction in vivo, so it needs to be further ameliorated[26,29,43].
In conclusion, through the study of many important factors in hypothermic preservation, we can optimize the hypothermic preservation protocols or cultivated conditions, and established a hepatocytes storage room. That will be helpful for the development of BAL and hepatocytes transplantation[9,40,48].
Wang YJ, Li MD, Wang YM, Nie QH, Chen GZ. Experimental study of bioartificial liver with cultured human liver cells.World J Gastroenterol. 1999;5:135-137.
[PubMed] [DOI][Cited in This Article: ]
Sarkis R, Honiger J, Chafai N, Baudrimont M, Sarkis K, Delelo R, Becquemont L, Benoist S, Balladur P, Capeau J. Semiautomatic macroencapsulation of fresh or cryopreserved porcine hepatocytes maintain their ability for treatment of acute liver failure.Cell Transplant. 2001;10:601-607.
[PubMed] [DOI][Cited in This Article: ]
Sarkis R, Benoist S, Honiger J, Baudrimont M, Delelo R, Balladur P, Capeau J, Nordlinger B. Transplanted cryopreserved encapsulated porcine hepatocytes are as effective as fresh hepatocytes in preventing death from acute liver failure in rats.Transplantation. 2000;70:58-64.
[PubMed] [DOI][Cited in This Article: ]
Sarkis R, Honiger J, Chafai N, Baudrimont M, Sarkis K, Delelo R, Becquemont L, Benoist S, Balladur P, Capeau J. Semiautomatic macroencapsulation of fresh or cryopreserved porcine hepatocytes maintain their ability for treatment of acute liver failure.Cell Transplant. 2001;10:601-607.
[PubMed] [DOI][Cited in This Article: ]
David P, Alexandre E, Audet M, Chenard-Neu MP, Wolf P, Jaeck D, Azimzadeh A, Richert L. Engraftment and albumin production of intrasplenically transplanted rat hepatocytes (Sprague-Dawley), freshly isolated versus cryopreserved, into Nagase analbuminemic rats (NAR).Cell Transplant. 2001;10:67-80.
[PubMed] [DOI][Cited in This Article: ]
Morsiani E, Pazzi P, Puviani AC, Brogli M, Valieri L, Gorini P, Scoletta P, Marangoni E, Ragazzi R, Azzena G. Early experiences with a porcine hepatocyte-based bioartificial liver in acute hepatic failure patients.Int J Artif Organs. 2002;25:192-202.
[PubMed] [DOI][Cited in This Article: ]
Gao Y, Xu XP, Hu HZ, Yang JZ. Cultivation of human liver cell lines with microcarriers acting as biological materials of bioartificial liver.World J Gastroenterol. 1999;5:221-224.
[PubMed] [DOI][Cited in This Article: ]
Gao Y, Hu HZ, Chen K, Yang JZ. Primary porcine hepatocytes with portal vein serum cultured on microcarriers or in spheroidal aggregates.World J Gastroenterol. 2000;6:365-370.
[PubMed] [DOI][Cited in This Article: ]
Yao YQ, Zhang DF, Huang AL, Luo Y, Zhang DZ, Wang B, Zhou WP, Ren H, Guo SH. Effects of electroporation on primary rat hepatocytes in vitro.World J Gastroenterol. 2002;8:893-896.
[PubMed] [DOI][Cited in This Article: ]
Xue YL, Zhao SF, Luo Y, Li XJ, Duan ZP, Chen XP, Li WG, Huang XQ, Li YL, Cui X. TECA hybrid artificial liver support system in treatment of acute liver failure.World J Gastroenterol. 2001;7:826-829.
[PubMed] [DOI][Cited in This Article: ]
Hengstler JG, Utesch D, Steinberg P, Platt KL, Diener B, Ringel M, Swales N, Fischer T, Biefang K, Gerl M. Cryopreserved primary hepatocytes as a constantly available in vitro model for the evaluation of human and animal drug metabolism and enzyme induction.Drug Metab Rev. 2000;32:81-118.
[PubMed] [DOI][Cited in This Article: ][Cited by in Crossref: 203][Cited by in F6Publishing: 196][Article Influence: 8.2][Reference Citation Analysis (0)]
Gerlach JC, Zeilinger K, Sauer IM, Mieder T, Naumann G, Grünwald A, Pless G, Holland G, Mas A, Vienken J. Extracorporeal liver support: porcine or human cell based systems?Int J Artif Organs. 2002;25:1013-1018.
[PubMed] [DOI][Cited in This Article: ]
Benoist S, Sarkis R, Chafaï N, Barbu V, Honiger J, Lakehal F, Becquemont L, Baudrimont M, Capeau J, Housset C. Survival and differentiation of porcine hepatocytes encapsulated by semiautomatic device and allotransplanted in large number without immunosuppression.J Hepatol. 2001;35:208-216.
[PubMed] [DOI][Cited in This Article: ][Cited by in Crossref: 5][Cited by in F6Publishing: 7][Article Influence: 0.3][Reference Citation Analysis (0)]
Vilei MT, Granato A, Ferraresso C, Neri D, Carraro P, Gerunda G, Muraca M. Comparison of pig, human and rat hepatocytes as a source of liver specific metabolic functions in culture systems--implications for use in bioartificial liver devices.Int J Artif Organs. 2001;24:392-396.
[PubMed] [DOI][Cited in This Article: ]
Nagaki M, Miki K, Kim YI, Ishiyama H, Hirahara I, Takahashi H, Sugiyama A, Muto Y, Moriwaki H. Development and characterization of a hybrid bioartificial liver using primary hepatocytes entrapped in a basement membrane matrix.Dig Dis Sci. 2001;46:1046-1056.
[PubMed] [DOI][Cited in This Article: ][Cited by in Crossref: 33][Cited by in F6Publishing: 33][Article Influence: 1.4][Reference Citation Analysis (0)]
Enosawa S, Miyashita T, Fujita Y, Suzuki S, Amemiya H, Omasa T, Hiramatsu S, Suga K, Matsumura T. In vivo estimation of bioartificial liver with recombinant HepG2 cells using pigs with ischemic liver failure.Cell Transplant. 2001;10:429-433.
[PubMed] [DOI][Cited in This Article: ]
Baust JM, Vogel MJ, Van Buskirk R, Baust JG. A molecular basis of cryopreservation failure and its modulation to improve cell survival.Cell Transplant. 2001;10:561-571.
[PubMed] [DOI][Cited in This Article: ]
Gao Y, Hu HZ, Chen K, Yang JZ. Primary porcine hepatocytes with portal vein serum cultured on microcarriers or in spheroidal aggregates.World J Gastroenterol. 2000;6:365-370.
[PubMed] [DOI][Cited in This Article: ]
De Smet K, Cavin C, Vercruysse A, Rogiers V. Collagen type I gel cultures of adult rat hepatocytes as a screening induction model for cytochrome P450-dependent enzymes.Altern Lab Anim. 2001;29:179-192.
[PubMed] [DOI][Cited in This Article: ]
Unger JK, Catapano G, Horn NA, Schroers A, Gerlach JC, Rossaint R. Comparative analysis of metabolism of medium- and plasma perfused primary pig hepatocytes cultured around a 3-D membrane network.Int J Artif Organs. 2000;23:104-110.
[PubMed] [DOI][Cited in This Article: ]
Tréhout D, Desille M, Doan BT, Mahler S, Frémond B, Mallédant Y, Campion JP, Desbois J, Beloeil JC, de Certaines J. Follow-up by one- and two-dimensional NMR of plasma from pigs with ischemia-induced acute liver failure treated with a bioartificial liver.NMR Biomed. 2002;15:393-403.
[PubMed] [DOI][Cited in This Article: ][Cited by in Crossref: 10][Cited by in F6Publishing: 8][Article Influence: 0.4][Reference Citation Analysis (0)]
Wang YJ, Li MD, Wang YM, Chen GZ, Lu GD, Tan ZX. Effect of extracorporeal bioartificial liver support system on fulminant hepatic failure rabbits.World J Gastroenterol. 2000;6:252-254.
[PubMed] [DOI][Cited in This Article: ]