Human papillomavirus does not have a causal role in colorectal carcinogenesis

Figure 1 Human papillomavirus 16 relative gene quantifications. Data obtained in human papillomavirus (HCV) 16 positive colorectal cancer tissues through real time polymerase chain reaction analysis by the ^ΔΔCT method, with W12 cells as a reference considered equal to 1. Primer sequences were as follows: A: E2: For GCAACGAAGTATCCTCTCCTG; Rev GCGA CGGCTTTGGTATGG; B: E4: For AATTATTAGGCAGCACTTGG; Rev GTCGTCTGTGTTTC TTCG; C: E5: For CGCTGCTTTTGTCTGTGTCT; Rev GCGTGCATGTGTATGTATTAAAAA; D: E6: For GCACCAAAAGAGAACTGCAATGTT; Rev AGTCATATACCTCACGTCGCGCA GTCA; E: E7: For CAAGTGTGACTCTACGCTTCGG; Rev GTGGCCCATTAACAGGTCTTC CAA. β-actin: For TCACCCACACTGTGCCCATCTACGA; Rev CAGCGGAACCGCTCAT TGCCAATGG. The thermal cycler conditions were: 95 °C for 3 min, followed by 40 cycles of 95 °C for 10 s and 60 °C for 30 s, followed by a melting curve starting at 55 °C.

Figure 2 Human papillomavirus 16 gene ng quantifications. A: E2 ng; B: E4 ng; C: E5 ng; D: E6 ng; E: E7 ng. Data obtained through real time polymerase chain reaction analysis, showing ng quantification of the house-keeping beta actin gene (white bars) and human papillomavirus (HPV) 16 genes (grey bars) in W12 cells and in HPV16-positive colorectal cancers.

Figure 3 mRNA expression in cell lines and colorectal cancers. A: Beta-actin mRNA levels: Quantitative real-time polymerase chain reaction (q-RT PCR) cycle thresholds (CTs) in cell lines and colorectal cancerous tissues; B: Negative RT PCR for human papillomavirus (HPV) E2 mRNA level in HPV-positive colorectal tissues.