Copyright
©The Author(s) 2022.
World J Clin Cases. Oct 6, 2022; 10(28): 10358-10365
Published online Oct 6, 2022. doi: 10.12998/wjcc.v10.i28.10358
Published online Oct 6, 2022. doi: 10.12998/wjcc.v10.i28.10358
Table 1 The identified DNA sequence of the fungi in the thrombi of the common iliac vein
Nucleotide sequence |
GTAGGTGAACCTGCGGAAGGATCATTAATTATGTTAAAGCGCCTTACCTTAGGGTTTCCTCTGGGGTAAGTGATTGCTTCTACACTGTGAAAATT |
- Citation: Kyuno D, Kubo T, Tsujiwaki M, Sugita S, Hosaka M, Ito H, Harada K, Takasawa A, Kubota Y, Takasawa K, Ono Y, Magara K, Narimatsu E, Hasegawa T, Osanai M. COVID-19-associated disseminated mucormycosis: An autopsy case report. World J Clin Cases 2022; 10(28): 10358-10365
- URL: https://www.wjgnet.com/2307-8960/full/v10/i28/10358.htm
- DOI: https://dx.doi.org/10.12998/wjcc.v10.i28.10358