Development of a multiplex polymerase chain reaction assay for detection of hepatitis C virus, hepatitis B virus, and human immunodeficiency virus 1

Table 2 In silico evaluation of selected primer-pairs that demonstrated their suitability for simultaneous detection of a wide range of subtypes for hepatitis C virus, hepatitis B virus, and human immunodeficiency virus 1 using triplex real-time polymerase chain reaction amplification

Virus	Primers		Primer Tm1(oC)	Intended matches	Amplicon size (bp)	Amplicon Tm2 (oC)	Ref.
HCV	Forward	GGTGCACGGTCTACGAGAC	60.15	HCV genotype 1 subtypes: 1a, 1b, 1c, 1g, and 1e. HCV genotype 2 subtypes: 2a, 2b, 2c, 2e, 2f, 2k, and 2m. HCV genotype 3 subtypes: 3a, 3b, 3g, 3i, and 3k. HCV genotype 4 subtypes: 4a, 4d, 4f, 4g, 4l, 4m, 4n, 4o, 4r, and 4v. HCV genotype 5 subtype: 5a. HCV genotype 6 subtypes: 6a, 6e, 6h, 6k, 6l, 6m, 6n, and 6r. HCV genotype 7 subtype: QC69. Unclassified HCV subtypes: 08.40.072, 08.80.075, 08.80.014, 08.80.070, 2b/1a, 2k/1b, and M2123. Recombinant HCV viruses	64	86.5	Chen et al[28], with modifications
	Reverse	GCCTTGTGGTACTGCCTGAT	60.04				Chen et al[28]
HBV	Forward	CTTCATCCTGCTGCTATGCCT	60.20	HBV genotypes A, A1, A2, and A3. HBV genotype B. HBV genotypes C and C1. HBV genotypes D and D4. HBV genotype E, including the relative Egyptian isolates AC# KU736891 and KU736892. HBV genotypes F, F2, and F4. HBV genotype G. HBV genotype H. HBV recombinant A/E. HBV recombinant B/C	71	80.5	Kishk et al[29]
	Reverse	GACAAACGGGCAACATACCTT	59.79				Prakash et al[30], with modifications
HIV	Forward	GCCTCAATAAAGCTTGCCTTGA	59.51	HIV type 1. Simian immunodeficiency virus	121	85.5	Rouet et al[31]
	Reverse	GGCGCCACTGCTAGAGATTTT	61.01

¹Primer melting temperature (Tm) and the amplicon size were determined using National Center for Biotechnology Information Primer-BLAST web-tool.

²Amplicon melting temperature was predicted using uMELT wed-based tool.

HCV: Hepatitis C virus; HBV: Hepatitis B virus; HIV-1: Human immunodeficiency virus 1.