Basic Study
Copyright ©The Author(s) 2024.
World J Virol. Mar 25, 2024; 13(1): 88164
Published online Mar 25, 2024. doi: 10.5501/wjv.v13.i1.88164
Table 2 In silico evaluation of selected primer-pairs that demonstrated their suitability for simultaneous detection of a wide range of subtypes for hepatitis C virus, hepatitis B virus, and human immunodeficiency virus 1 using triplex real-time polymerase chain reaction amplification
Virus
Primers
Primer Tm1(oC)
Intended matches
Amplicon size (bp)
Amplicon Tm2 (oC)
Ref.
HCVForwardGGTGCACGGTCTACGAGAC60.15HCV genotype 1 subtypes: 1a, 1b, 1c, 1g, and 1e. HCV genotype 2 subtypes: 2a, 2b, 2c, 2e, 2f, 2k, and 2m. HCV genotype 3 subtypes: 3a, 3b, 3g, 3i, and 3k. HCV genotype 4 subtypes: 4a, 4d, 4f, 4g, 4l, 4m, 4n, 4o, 4r, and 4v. HCV genotype 5 subtype: 5a. HCV genotype 6 subtypes: 6a, 6e, 6h, 6k, 6l, 6m, 6n, and 6r. HCV genotype 7 subtype: QC69. Unclassified HCV subtypes: 08.40.072, 08.80.075, 08.80.014, 08.80.070, 2b/1a, 2k/1b, and M2123. Recombinant HCV viruses6486.5Chen et al[28], with modifications
ReverseGCCTTGTGGTACTGCCTGAT60.04Chen et al[28]
HBVForwardCTTCATCCTGCTGCTATGCCT60.20HBV genotypes A, A1, A2, and A3. HBV genotype B. HBV genotypes C and C1. HBV genotypes D and D4. HBV genotype E, including the relative Egyptian isolates AC# KU736891 and KU736892. HBV genotypes F, F2, and F4. HBV genotype G. HBV genotype H. HBV recombinant A/E. HBV recombinant B/C7180.5Kishk et al[29]
ReverseGACAAACGGGCAACATACCTT59.79Prakash et al[30], with modifications
HIVForwardGCCTCAATAAAGCTTGCCTTGA59.51HIV type 1. Simian immunodeficiency virus12185.5Rouet et al[31]
ReverseGGCGCCACTGCTAGAGATTTT61.01