Copyright
©The Author(s) 2015.
World J Clin Infect Dis. Nov 25, 2015; 5(4): 86-93
Published online Nov 25, 2015. doi: 10.5495/wjcid.v5.i4.86
Published online Nov 25, 2015. doi: 10.5495/wjcid.v5.i4.86
Table 1 Primers and probes used in this study
| Gene | Forward primer 5'-3' | Reverse primer 5'-3' | Probe 5'-3' | Ref. |
| tuf | tcctggttcaattacaccacatactg | ggaaatagaattgtggacgatagtttga | FAM-tgataatacrtawacttctgc-BHQ1 | [24] |
| 16S | acggtcttgctgtcactta | tacacatatgttcttccctaataa | VIC-gtaacggcttaccaaggc-BHQ1 | [22] |
-
Citation: Loonen AJ, Wolffs PF, de Bresser M, Habraken M, Bruggeman CA, Hermans MH, van den Brule AJ.
Tuf mRNA rather than 16S rRNA is associated with culturableStaphylococcus aureus . World J Clin Infect Dis 2015; 5(4): 86-93 - URL: https://www.wjgnet.com/2220-3176/full/v5/i4/86.htm
- DOI: https://dx.doi.org/10.5495/wjcid.v5.i4.86