Copyright
©20???? Baishideng Publishing Group Co.
World J Hepatol. Feb 27, 2011; 3(2): 56-60
Published online Feb 27, 2011. doi: 10.4254/wjh.v3.i2.56
Published online Feb 27, 2011. doi: 10.4254/wjh.v3.i2.56
Table 2 Primers for the amplification of the precore region and all remaining regions of hepatitis B virus DNA in nested polymerase chain reaction
Primer | Sequence | Positiona | |
PreC region | 1st forward | 5'GGGAGGAGATTAGGTTAA3' | 1744 |
1st reverse | 5'GGCAAAAAAGAGAGTAACTC3' | 1959 | |
2nd forward | 5'TAGGAGGCTGTAGGCATAA3' | 1774 | |
2nd reverse | 5'GCTCCAAATTCTTTATA3' | 1932 | |
Cycling protocol: 94°C 1 min - 55°C 1 min - 68°C 3 min (25 cycles) | |||
All remaining regions (long PCR) | 1st forward | 5'CCTATAAAGAATTTGGAGC3' | 1914 |
1st reverse | 5'TTTATGCCTACAGCCTCC3' | 1793 | |
2nd forward | 5'GAGTTACTCTCTTTTTTGC3' | 1940 | |
2nd reverse | 5'ACCTTTAACCTAATCTCCT3' | 1765 | |
Cycling protocol: 95°C 1 min - 57°C 1 min - 68°C 3 min (35 cycles) |
- Citation: Fujise K, Tatsuzawa K, Kono M, Hoshina S, Tsubota A, Niiya M, Namiki Y, Tada N, Tajiri H. A mutation of the start codon in the X region of hepatitis B virus DNA in a patient with non-B, non-C chronic hepatitis. World J Hepatol 2011; 3(2): 56-60
- URL: https://www.wjgnet.com/1948-5182/full/v3/i2/56.htm
- DOI: https://dx.doi.org/10.4254/wjh.v3.i2.56