A mutation of the start codon in the X region of hepatitis B virus DNA in a patient with non-B, non-C chronic hepatitis

Advanced Search

BPG is committed to discovery and dissemination of knowledge

Home / Archive / Volume 3, Issue 2

This Article

Citation of this article

Corresponding Author of This Article

Article-Type of This Article

Open-Access Policy of This Article

Times Cited Counts in Google of This Article

Number of Hits and Downloads for This Article

All Articles published online

Item

Count

PDF

343

HTML

2601

Figures (1-1)

227

Tables (1-2)

224

Sum=3395

Feb 27, 2011 (publication date) through Nov 25, 2024

Times Cited of This Article

Journal Information of This Article

Publication Name

World Journal of Hepatology

ISSN

1948-5182

Publisher of This Article

Baishideng Publishing Group Inc, 7041 Koll Center Parkway, Suite 160, Pleasanton, CA 94566, USA

Case Report

World J Hepatol. Feb 27, 2011; 3(2): 56-60
Published online Feb 27, 2011. doi: 10.4254/wjh.v3.i2.56

Table 2 Primers for the amplification of the precore region and all remaining regions of hepatitis B virus DNA in nested polymerase chain reaction

	Primer	Sequence	Position^a
PreC region	1st forward	5'GGGAGGAGATTAGGTTAA3'	1744
	1st reverse	5'GGCAAAAAAGAGAGTAACTC3'	1959
	2nd forward	5'TAGGAGGCTGTAGGCATAA3'	1774
	2nd reverse	5'GCTCCAAATTCTTTATA3'	1932
	Cycling protocol: 94°C 1 min - 55°C 1 min - 68°C 3 min (25 cycles)
All remaining regions (long PCR)	1st forward	5'CCTATAAAGAATTTGGAGC3'	1914
	1st reverse	5'TTTATGCCTACAGCCTCC3'	1793
	2nd forward	5'GAGTTACTCTCTTTTTTGC3'	1940
	2nd reverse	5'ACCTTTAACCTAATCTCCT3'	1765
	Cycling protocol: 95°C 1 min - 57°C 1 min - 68°C 3 min (35 cycles)

^aHBV DNA is composed of 3215 bases and starts from the Eco RI cleavage site within pre-S/S open reading frame[9]. PCR: polymerase chain reaction.

Citation: Fujise K, Tatsuzawa K, Kono M, Hoshina S, Tsubota A, Niiya M, Namiki Y, Tada N, Tajiri H. A mutation of the start codon in the X region of hepatitis B virus DNA in a patient with non-B, non-C chronic hepatitis. World J Hepatol 2011; 3(2): 56-60
URL: https://www.wjgnet.com/1948-5182/full/v3/i2/56.htm
DOI: https://dx.doi.org/10.4254/wjh.v3.i2.56