Copyright
©The Author(s) 2020.
World J Hepatol. Apr 27, 2020; 12(4): 137-148
Published online Apr 27, 2020. doi: 10.4254/wjh.v12.i4.137
Published online Apr 27, 2020. doi: 10.4254/wjh.v12.i4.137
Table 1 Probes and conditions used in the polymerase chain reaction to genotype interleukin 6 single nucleotide polymorphism at position-174 (rs1800795)
| IL-6 Gene-174 (rs1800795) | |
| ACTTTTCCCCCTAGTTGTGTCTTGC[C/G]ATGCTAAAGGACGTCACATTGCACA | 60 ºC–1 min; 95 ºC–10 min; 50 cycles (95 ºC–15 s, 60 ºC–90 s) and 60 ºC–1 min |
- Citation: da Silva CB, Vieira DA, de Melo LF, Chagas ALS, Gomes AD, Faria Jr CLL, Teixeira R, de Magalhães Queiroz DM, Rocha GA, Soares MMS, Bezerra JMT, Silva LD. Interleukin-6-174G/C polymorphism is associated with a decreased risk of type 2 diabetes in patients with chronic hepatitis C virus. World J Hepatol 2020; 12(4): 137-148
- URL: https://www.wjgnet.com/1948-5182/full/v12/i4/137.htm
- DOI: https://dx.doi.org/10.4254/wjh.v12.i4.137