Transforming growth factor-β1 gene polymorphisms are associated with progression of liver fibrosis in Caucasians with chronic hepatitis C infection

Table 1 LC Protocol 1 for Genotyping the TGF-β1 Gene Polymorphisms.

Codon 10 (Leu10Pro)
Time (s)	Temp (°C)	Transition Rate (°C/s)	Cycles
600	95	20	1	Denaturation
10	95	20	45	Cycling
10	59	20
20	72	20
60	95	20	1	Melting curve
				Analysis
30	45	20
0	78	0.2
5-d(CTAGGTTATTTCCGTGGG)-3’				Sense primer
5-d(CCTTGGCGTAGTAGTCG)-3’				Reverse primer
5-d(TCCCCCATGCCGCCCTCCGGGCT-Fluo)-3’				Anchor primer
5-LCRed640-(CGGCTGCTGCCGCTGCT-P)-3’				Sensor primer

Table 2 LC Protocol 2 for Genotyping the TGF-β1 Gene Polymorphisms.

Codon 25 (Arg25Pro)
Time (s)	Temp (°C)	Transition Rate (°C/s)	Cycles
600	95	20	1	Denaturation
10	95	20	45	Cycling
10	59	20
20	72	20
60	95	20	1	Melting curve
				Analysis
30	40	20
0	80	0.2
5-d(CTAGGTTATTTCCGTGGG)-3’				Sense primer
5-d(CCTTGGCGTAGTAGTCG)-3’				Reverse primer
5-d(GCTACCGCTGCTGTGGCTACTGGTGCT-Fluo)-3				Anchor primer
5-LCRed640-(ACGCCTGGCCCGCCG-P)-3’				Sensor primer

Table 3 LC Protocol 3 for Genotyping the TGF-β1 Gene Polymorphisms.

Codon 263 (Thr263Ile)
Time (s)	Temp (°C)	Transition Rate (°C/s)	Cycles
600	95	20	1	Denaturation
10	95	20	45	Cycling
10	59	20
20	72	20
60	95	20	1	Melting curve
				Analysis
30	39	20
0	74	0.2
5-d(AAGCAGGGTTCACTACCGGC)-3’				Sense primer
5-d(AGGCCTCCATCCAGGCTACA)-3’				Reverse primer
5-LCRed640-(GAGAGGGCCCAGCATCTGCAAAGCT-P)-3				Anchor primer
5-d(ATGGCCACCCCGCT-Fluo)-3’				Sensor primer

Table 4 TGF-β1 gene polymorphisms in subjects of Chinese and Caucasian origin.

Ethnic group	n	Subjects	Codon 25	n	Codon 10	n	Codon 263	n
Chinese	194	Controls	Arg/Arg	104	Leu/Leu	29	Thr/Thr	104
					Leu/Pro	49
					Pro/Pro	26
		Patients	Arg/Arg	90	Leu/Leu	21	Thr/Thr	90
					Leu/Pro	38
					Pro/Pro	31
Caucasians	260	Controls	Arg/Arg	42	Leu/Leu	19	Thr/Thr	19
					Leu/Pro	20	Thr/Thr	17
							Thr/Ile	3
					Pro/Pro	3	Thr/Thr	2
							Thr/Ile	1
			Arg/Pro	8	Leu/Leu	0
					Leu/Pro	7	Thr/Thr	7
					Pro/Pro	1	Thr/Ile	1
		Patients	Arg/Arg	178	Leu/Leu	87	Thr/Thr	85
							Thr/Ile	2
					Leu/Pro	80	Thr/Thr	74
							Thr/Ile	6
					Pro/Pro	11	Thr/Thr	7
							Thr/Ile	4
			Arg/Pro	32	Leu/Leu	0
					Leu/Pro	20	Thr/Thr	20
					Pro/Pro	12	Thr/Thr	10
							Thr/Ile	2

Table 5 TGF-β1 Allelic Frequencies.

Polymorphic site	Chinese			Caucasians
	Total (n = 194)	Controls(n = 104)	Patients(n = 90)	Total(n = 260)	Controls(n = 50)	Patients (n = 210)
Codon 10 (T/C)	0.50/0.50	0.51/0.49	0.44/0.56	0.65/0.35	0.65/0.35	0.65/0.35
Codon 25 (G/C)	1/0	1/0	1/0	0.92/0.08	0.92/0.08	0.92/0.08
Codon 263 (C/T)	1/0	1/0	1/0	0.96/0.04	0.95/0.05	0.97/0.03

Table 6 Genotype distribution of codon 10, 25, and 263 polymorphisms and grade of fibrosis in caucasian patients (n = 200) with chronic hepatitis C infection.

Codon	Genotype	Total	F0-2	F3-4
10	Leu/Leu	82	70	12
	Leu/Pro	95	69	26
	Pro/Pro	23	17	6
25	Arg/Arg	169	137	32
	Arg/Pro	31	19	12
	Pro/Pro	0	0	0
263	Thr/Thr	186	145	41
	Thr/Ile	14	11	3
	Ile/Ile	0	0	0