Copyright
©The Author(s) 2002.
World J Gastroenterol. Jun 15, 2002; 8(3): 520-523
Published online Jun 15, 2002. doi: 10.3748/wjg.v8.i3.520
Published online Jun 15, 2002. doi: 10.3748/wjg.v8.i3.520
Primer designation | Sequence | Product length |
α1 (I) upstream | CACCCTCAAGAGCCTGAGTC | 253 bp |
α1 (I) downstream | GTT CGGGCTGATGTACCAGT | |
β-actin upstream | ACATCTGCTGGAAGGTGGAC | 163 bp |
β-actin downstream | GGTACCACCATGTACCCAGG |
- Citation: Cheng ML, Wu J, Wang HQ, Xue LM, Tan YZ, Ping L, Li CX, Huang NH, Yao YM, Ren LZ, Ye L, Li L, Jia ML. Effect of Maotai liquor in inducing metallothioneins and on hepatic stellate cells. World J Gastroenterol 2002; 8(3): 520-523
- URL: https://www.wjgnet.com/1007-9327/full/v8/i3/520.htm
- DOI: https://dx.doi.org/10.3748/wjg.v8.i3.520