Mechanistic research: Selenium regulates virulence factors, reducing adhesion ability and inflammatory damage of Helicobacter pylori

doi:10.3748/wjg.v30.i1.91

Advanced Search

BPG is committed to discovery and dissemination of knowledge

Home / Archive / Volume 30, Issue 1

This Article

Academic Content and Language Evaluation of This Article

CrossCheck and Google Search of This Article

Academic Rules and Norms of This Article

Supplementary Materials of This Article

Citation of this article

Corresponding Author of This Article

Research Domain of This Article

Article-Type of This Article

Open-Access Policy of This Article

Times Cited Counts in Google of This Article

Number of Hits and Downloads for This Article

Total Article Views (2041)

All Articles published online

The chart showing PDF series, WORD series, HTML series, Figures (1-5) series, Tables (1-4) series.

Item

Count

PDF

100

WORD

HTML

1055

Figures (1-5)

133

Tables (1-4)

116

Sum=1431

Publishing Process of This Article

The chart showing Browse series, Download series.

Item

Count

Browse

116

Download

403

Sum=519

Jan 7, 2024 (publication date) through Jul 4, 2024

Times Cited of This Article

Times Cited (1)

Journal Information of This Article

Publication Name

World Journal of Gastroenterology

ISSN

1007-9327

Publisher of This Article

Baishideng Publishing Group Inc, 7041 Koll Center Parkway, Suite 160, Pleasanton, CA 94566, USA

Basic Study

World J Gastroenterol. Jan 7, 2024; 30(1): 91-107
Published online Jan 7, 2024. doi: 10.3748/wjg.v30.i1.91

Table 1 Primer list

Name	Sequence	Company performing synthesis
CagA	F: ACCCCTAGTCGGTAATG	Shanghai Invitrogen Biotech Co., Ltd.
CagA	R: GCTTTAGCTTCTGATACTGC	Shanghai Invitrogen Biotech Co., Ltd.
VacAs1a	F: GTCAGCATCACACCGCAAC	Shanghai Generay Biotech Co., Ltd.
VacAs1a	R: CTGCTTGAATGCGCCAAAC	Shanghai Generay Biotech Co., Ltd.
16sRNA	F: CTGGAGAGACTAAGCCCTCC	Shanghai Invitrogen Biotech Co., Ltd.
16sRNA	R: AGGATCAAGGTTTAAGGATT	Shanghai Invitrogen Biotech Co., Ltd.
IL-6	F: GCAGAAAAAGGCAAAGAATC	Wuhan Genecreate Biotech Co., Ltd.
IL-6	R: CTACATTTGCCGAAGAGC	Wuhan Genecreate Biotech Co., Ltd.
IL-8	F: CACCGGAAGGAACCATCTCA	Wuhan Genecreate Biotech Co., Ltd.
IL-8	R: TGGCAAAACTGCACCTTCACA	Wuhan Genecreate Biotech Co., Ltd.
TNF-α	F: TCTTCTCGAACCCCGAGTGA	Wuhan Genecreate Biotech Co., Ltd.
TNF-α	R: CCTCTGATGGCACCACCAG	Wuhan Genecreate Biotech Co., Ltd.
GAPDH	F: GGACCTGACCTGCCGTCTAG	Wuhan Genecreate Biotech Co., Ltd.
GAPDH	R: GTAGCCCAGGATGCCCTTGA	Wuhan Genecreate Biotech Co., Ltd.
Cag1	F: GCTATGGGGATTGTTGGGATAA	Shanghai Sangon Biotech Co., Ltd.
Cag1	R: GCTTCAGTTGGTTCGTTGGTAA	Shanghai Sangon Biotech Co., Ltd.
Cag3	F: GACACCTTGAATGTGAATGACAAA	Shanghai Sangon Biotech Co., Ltd.
Cag3	R: GTTGTAATACCCATTGACTTGCTCTAA	Shanghai Sangon Biotech Co., Ltd.
CagT	F: TCTAAAAAGATTACGCTCATAGGCG	Shanghai Sangon Biotech Co., Ltd.
CagT	R: CTTTGGCTTGCATGTTCAAGTTGCC	Shanghai Sangon Biotech Co., Ltd.
CagE	F: GCGATTGTTATTGTGCTTGTAG	Shanghai Sangon Biotech Co., Ltd.
CagE	R: GAAGTGGTTAAAAAATCAATGCCCC	Shanghai Sangon Biotech Co., Ltd.
CagM	F: ACAAATACAAAAAAGAAAAAGAGGC	Shanghai Sangon Biotech Co., Ltd.
CagM	R: ATTTTTCAACAAGTTAGAAAAAGCC	Shanghai Sangon Biotech Co., Ltd.

16sRNA: 16S ribosomal RNA; CagA: Cytotoxin-associated protein A; GAPDH: Glyceraldehyde 3-phosphate dehydrogenase; IL-6: Interleukin 6; TNF-a: Tumor necrosis factor-alpha; VacAs1a: Vacuolating cytotoxin gene As1a.

Citation: Qin C, Huang GR, Guan AX, Zhou WT, Chen H, Luo PP, Luo XK, Huang YQ, Huang ZS. Mechanistic research: Selenium regulates virulence factors, reducing adhesion ability and inflammatory damage of Helicobacter pylori. World J Gastroenterol 2024; 30(1): 91-107
URL: https://www.wjgnet.com/1007-9327/full/v30/i1/91.htm
DOI: https://dx.doi.org/10.3748/wjg.v30.i1.91