Copyright
©The Author(s) 2023.
World J Gastroenterol. Aug 21, 2023; 29(31): 4783-4796
Published online Aug 21, 2023. doi: 10.3748/wjg.v29.i31.4783
Published online Aug 21, 2023. doi: 10.3748/wjg.v29.i31.4783
Table 2 Primer sequences
Gene | Sequence (5’-3’) | Tm (°C) | |
GAPDH | Forward primer | GAAAGCCTGCCGGTGACTAA | 60.32 |
Reverse primer | GCCCAATACGACCAAATCAGAG | 59.39 | |
PARN | Forward primer | GCCGCGGAATTCGATTTTAAG | 58.63 |
Reverse primer | ATCGATGGCGAAGAAGTCGG | 60.25 |
- Citation: Zhang FW, Xie XW, Chen MH, Tong J, Chen QQ, Feng J, Chen FT, Liu WQ. Poly(A)-specific ribonuclease protein promotes the proliferation, invasion and migration of esophageal cancer cells. World J Gastroenterol 2023; 29(31): 4783-4796
- URL: https://www.wjgnet.com/1007-9327/full/v29/i31/4783.htm
- DOI: https://dx.doi.org/10.3748/wjg.v29.i31.4783