Copyright
©The Author(s) 2022.
World J Gastroenterol. Jan 14, 2022; 28(2): 242-262
Published online Jan 14, 2022. doi: 10.3748/wjg.v28.i2.242
Published online Jan 14, 2022. doi: 10.3748/wjg.v28.i2.242
Table 7 Summary of the in silico predicted composite regulatory elements for the -146 to +10 region of tumor necrosis factor-alpha
| Composite element | MatrixName for a 1st element | Score, strand | Distance in between | MatrixName for a 2nd element | Score, strand | Position of CE, orientation | orientation | Composite score | P value | Sequence |
| CE00266 | V$ETS_Q6 | 0.991+ | 12 | V$AP1_Q2_01 | 0.831+ | -118 | + | 0 | 1.08e-03 | GCTTCCTCCagaTGAGCTCATGGG |
| CE00109 | V$AP1_C | 0.853- | 8 | V$NFAT_Q6 | 0.943- | -66 | - | 0.007 | 3.42e-03 | TTGAATGATTCTTTCCCCGC |
| CE00150 | V$AP1_C | 0.853- | 8 | V$NFAT_Q6 | 0.943- | -66 | - | -0.237 | 3.42e-03 | TTGAATGATTCTTTCCCCGC |
| CE00058 | V$HMGIY_Q6 | 0.955- | -5 | V$NFKB_Q6_01 | 0.759- | -78 | - | -0.09 | 6.89e-03 | GTTTTCCGCTG |
| CE00058 | V$HMGIY_Q6 | 0.955- | -4 | V$NFKB_Q6_01 | 0.662- | -78 | - | 0.005 | 9.20e-03 | GTTTTCCGCTGG |
| CE00064 | V$HNF3_Q6 | 0.780+ | 15 | V$NF1_Q6 | 0.956+ | -28 | + | -0.254 | 4.83e-02 | ACATATAAAGGCAGtTGTTGGCACACCCAGCCA |
- Citation: Idris AB, Idris AB, Gumaa MA, Idris MB, Elgoraish A, Mansour M, Allam D, Arbab BM, Beirag N, Ibrahim EAM, Hassan MA. Identification of functional tumor necrosis factor-alpha promoter variants associated with Helicobacter pylori infection in the Sudanese population: Computational approach. World J Gastroenterol 2022; 28(2): 242-262
- URL: https://www.wjgnet.com/1007-9327/full/v28/i2/242.htm
- DOI: https://dx.doi.org/10.3748/wjg.v28.i2.242