Copyright
©The Author(s) 2020.
World J Gastroenterol. Apr 28, 2020; 26(16): 1926-1937
Published online Apr 28, 2020. doi: 10.3748/wjg.v26.i16.1926
Published online Apr 28, 2020. doi: 10.3748/wjg.v26.i16.1926
Table 2 Mutation status of LKB1/STK11 gene
Case No. | Allele | Mutation type | Exon/intron | Amino acid change | Base change | New mutation |
1 | Heterozygosis | Missense | 4 | p.L167R | c.500T>G | No |
2 | Heterozygosis | Nonsense | 1 | p.K84* | c.250A>T | No |
3 | Heterozygosis | Frameshift deletion | 5 | p.A241Vfs*46 | c.722delC | Yes |
4 | Homozygous | Frameshift insertion | 3 | p.Q152Pfs*11 | c.454_455insC | Yes |
5 | Heterozygosis | Frameshift insertion | 1 | p.Y49Afs*4 | c.144_145insGCAAG | Yes |
6 | Heterozygosis | Missense | 5 | p.S240W | c.719C>G | No |
7 | Heterozygosis | Frameshift deletion | 1 | p.K82Rfs*14 | c.243delG | Yes |
8 | Heterozygosis | Cleavage site | 5-61 | / | c.734+1G>A | Yes |
10 | Heterozygosis | Cleavage site | 3-41 | / | c.464+1G>T | Yes |
13 | Homozygous | Frameshift deletion | 3 | p.E145Gfs*10 | c.426_448delCGTGCCGGAGAAGCGTTTCCCAG | No |
14 | Heterozygosis | Nonsense | 1 | p.K84* | c.250A>T | No |
16 | Heterozygosis | Frameshift insertion | 1 | p.Y49Afs*4 | c.144_145insGCAAG | No |
17 | Heterozygosis | Cleavage site | 4-51 | / | c.598-1G>A | Yes |
18 | Heterozygosis | Nonsense | 1 | p.Y49* | c.147C>G | No |
19 | Heterozygosis | Frameshift deletion | 2 | p.K122Afs*40 | c.363_364delGA | Yes |
20 | Homozygosis | Cleavage site | 3-41 | / | c.464+1G>A | No |
- Citation: Zhang Z, Duan FX, Gu GL, Yu PF. Mutation analysis of related genes in hamartoma polyp tissue of Peutz-Jeghers syndrome. World J Gastroenterol 2020; 26(16): 1926-1937
- URL: https://www.wjgnet.com/1007-9327/full/v26/i16/1926.htm
- DOI: https://dx.doi.org/10.3748/wjg.v26.i16.1926