Copyright
©2014 Baishideng Publishing Group Inc.
World J Gastroenterol. Sep 21, 2014; 20(35): 12542-12550
Published online Sep 21, 2014. doi: 10.3748/wjg.v20.i35.12542
Published online Sep 21, 2014. doi: 10.3748/wjg.v20.i35.12542
Table 1 Primers used for nested reverse transcriptase polymerase chain reaction amplification of cholecystokinin-B receptor, extracellular signal-regulated protein kinase 1/2 and K-ras
Name | Primer sequence | PCR conditions | Size (bp) |
CCK-BR | 1: 5’TCTCGCGAGCTCTACTTAGGG3’ | 94 °C, 30 s | 185 |
2: 5’ACCGACGATGCACGTTGAAG3’ | 62 °C, 30 s | ||
72 °C, 30 s | |||
ERK1/2 | 1: 5’TATTCCCGGGCAAGCACTATTT3’ | 94 °C, 30 s | 243 |
2: 5’CGGGCTCATCATTCGGGTCGTA3’ | 54 °C, 30 s | ||
72 °C, 30 s | |||
K-ras | 1: 5’ACAGTGCAATGAGGGACCAGTA3’ | 94 °C, 30 s | 275 |
2: 5’GTATAGAAGGCATCATCAACACC3’ | 50 °C, 30 s | ||
72 °C, 30 s | |||
Actin | 1: 5’ATGATATCGCCGCGCTCGTCGTC3’ | 94 °C, 30 s | 342 |
2: 5’CGCGGTTGGCCTTGGGGTTCAG3’ | 60 °C, 30 s | ||
72 °C, 30 s |
- Citation: Mao JD, Wu P, Huang JX, Wu J, Yang G. Role of ERK-MAPK signaling pathway in pentagastrin-regulated growth of large intestinal carcinoma. World J Gastroenterol 2014; 20(35): 12542-12550
- URL: https://www.wjgnet.com/1007-9327/full/v20/i35/12542.htm
- DOI: https://dx.doi.org/10.3748/wjg.v20.i35.12542