Copyright
©2014 Baishideng Publishing Group Co.
World J Gastroenterol. Mar 28, 2014; 20(12): 3327-3334
Published online Mar 28, 2014. doi: 10.3748/wjg.v20.i12.3327
Published online Mar 28, 2014. doi: 10.3748/wjg.v20.i12.3327
Table 2 Primer sequences used to identify the G238C, G460A, and A719G polymorphisms of the thiopurine-methyl-transferase gene
Name | Sequence | Product size |
P2W reverse | 5’ GTA TGA TTT TAT GACGGT TG 3’ | 254 |
P2M reverse | 5’ GTA TGA TTT TATGCA GGT TTC 3’ | |
P2C forward | 5’ TAA ATAGGAACC ATCGGA CAC 3’ | |
460 forward | 5’ TCC CCA AAT CAT AAC AGA GTG 3’ | 375 |
460 reverse | 5’ CTAGAACCCAGAAAAAGTATAG3’ | |
719 forward | 5’ CGT TGT CTT GAG AAG GTT GA 3’ | 175 |
719 reverse | 5’ CAT TAC ATT TTC AGG CTT TAG CAT A 3’ |
- Citation: Carvalho ATP, Esberard BC, Fróes RSB, Rapozo DCM, Grinman AB, Simão TA, Santos JCVC, Carneiro AJV, Ribeiro-Pinto LF, Souza HSP. Thiopurine-methyltransferase variants in inflammatory bowel disease: Prevalence and toxicity in Brazilian patients. World J Gastroenterol 2014; 20(12): 3327-3334
- URL: https://www.wjgnet.com/1007-9327/full/v20/i12/3327.htm
- DOI: https://dx.doi.org/10.3748/wjg.v20.i12.3327