Copyright
©2012 Baishideng Publishing Group Co.
World J Gastroenterol. Feb 7, 2012; 18(5): 425-434
Published online Feb 7, 2012. doi: 10.3748/wjg.v18.i5.425
Published online Feb 7, 2012. doi: 10.3748/wjg.v18.i5.425
Table 1 The sequence of primers used and the target region of cell division-related gene A amplified with combination of primers
Primers | Sequence (5’-3’) | Reference | Combination of primers | Target region of cell division-related gene A |
P1 (forward) | TGAAGCACACGAAAGGA | 17 | P1-P3 | N-terminal to central |
P3 (reverse) | CATGCTCTAAAATCGTCG | 17 | P1-P3J | N-terminal to central |
P3J (reverse) | ATCACCACGATCAGTCTG | This study | P3-P4 | Central |
P4 (forward) | TTTTGAGATCGGTGAAGC | 17 | P3J-P4J | Central |
P4J (forward) | AACCACACGCTCATTTGC | This study | P4-P9J | Central to C-terminal |
P9J (reverse) | GCTGAAAGGCCTGAATTCAG | This study | P4J-P9J | Central to C-terminal |
-
Citation: Takeuchi H, Zhang YN, Israel DA, Peek Jr RM, Kamioka M, Yanai H, Morimoto N, Sugiura T. Effect of
Helicobacter pylori cdrA on interleukin-8 secretions and nuclear factor kappa B activation. World J Gastroenterol 2012; 18(5): 425-434 - URL: https://www.wjgnet.com/1007-9327/full/v18/i5/425.htm
- DOI: https://dx.doi.org/10.3748/wjg.v18.i5.425