Copyright
©2012 Baishideng Publishing Group Co.
World J Gastroenterol. Jun 7, 2012; 18(21): 2619-2629
Published online Jun 7, 2012. doi: 10.3748/wjg.v18.i21.2619
Published online Jun 7, 2012. doi: 10.3748/wjg.v18.i21.2619
Table 1 Primers used for real-time polymerase chain reaction amplification of 16S rRNA gene
PCR assay | Primers | Primers Sequences 5’→3’ | Accession number (NCBI) | Linear regression curves with coefficient of correlation | Sources of reference |
Total Bacteria | UnivF | TCCTACGGGAGGCAGCAGTG | - | Y = -2.941 x + 36.580 | Watanabe et al[21], 2001 |
UnivR | TTACCGCGGCTGCTGGCACG | r² = 0.9997 | Nadkarni et al[22], 2002 | ||
Bacteroidetes | BacF | CCTWCGATGGATAGGGGTT | - | Y = -2.908 x + 35.839 | Firmesse et al[23], 2008 |
BactR | TCCCCAGGTGGAATACTTAACG | r² = 0.9995 | |||
Enterobacteria | EntF | CATTGACGTTACCCGCAGAAGAA | AX110239/AX109631 | Y = -3.192 x + 36.762 | This study |
EntR | CGCTTGCACCCTCCGTATTA | AF293850/U26176 | r² = 0.9747 | ||
Firmicutes | FirmF | ACCCGCGTCTGATTAGCTAGTT | M59090/L34627 | Y = -3.298 x + 39.136 | This study |
FirmR | CCTCTCAGGCCGGCTACTG | Y10584/FJ345661 | r² = 0.9924 |
- Citation: Ettreiki C, Gadonna-Widehem P, Mangin I, Coëffier M, Delayre-Orthez C, Anton PM. Juvenile ferric iron prevents microbiota dysbiosis and colitis in adult rodents. World J Gastroenterol 2012; 18(21): 2619-2629
- URL: https://www.wjgnet.com/1007-9327/full/v18/i21/2619.htm
- DOI: https://dx.doi.org/10.3748/wjg.v18.i21.2619