Copyright
©2012 Baishideng Publishing Group Co.
World J Gastroenterol. Mar 21, 2012; 18(11): 1235-1242
Published online Mar 21, 2012. doi: 10.3748/wjg.v18.i11.1235
Published online Mar 21, 2012. doi: 10.3748/wjg.v18.i11.1235
Table 1 Primer sequences, restriction enzymes and fragment sizes for toll-like receptor 2 and toll-like receptor 4 gene polymorphisms and interleukin-1β gene
Genes | Primers | Enzyme T°/time | Fragment (bp) | Ref. |
TLR2 | F: 5’-CACGGAGGCAGCGAGAAA-3’ | - | 286 | [24] |
del -196 to -174 | R: 5’-CTGGGCCGTGCAAAGAAG-3’ | ins/ins: 286 | ||
ins/del: 286, 264 | ||||
del/del: 264 | ||||
TLR4+896A/G | F: 5’-AGCATACTTAGACTACCACCTCGATG 3’ | BstXI | 131 | [34] |
rs4986790 | R: 5’-GTTGCCATCCGAAATTATAAGAAAAG 3’ | 37 °C, 1 h | A/A: 131 | |
A/G: 131, 108 | ||||
G/G: 108 | ||||
TLR4+1196C/T | F: 5’-GGTTGCTGTTCTCAAAGTGATTTTGGGAGAA-3’ | HinfI | 407 | [33] |
rs4986791 | R: 5’-ACCTGAAGACTGGAGAGTGAGTTAAATGCT-3’ | 37 °C, 1 h | C/C: 407 | |
C/T: 407, 378 | ||||
T/T: 378 | ||||
IL1-β | F: CATGTGACCTGCTCGTCAGT | HinfI | 370 | [47] |
R: CCCTAGGGATTGAGTCCACA | 37 °C, 1 h | 195, 175 | ||
TLR2 | F: 5’-CACGGAGGCAGCGAGAAA-3’ | BstXI | 286 | [24] |
R: 5’-CTGGGCCGTGCAAAGAAG-3’ | 37 °C, 1 h | 188, 98 |
-
Citation: de Oliveira JG, Silva AE. Polymorphisms of the
TLR2 andTLR4 genes are associated with risk of gastric cancer in a Brazilian population. World J Gastroenterol 2012; 18(11): 1235-1242 - URL: https://www.wjgnet.com/1007-9327/full/v18/i11/1235.htm
- DOI: https://dx.doi.org/10.3748/wjg.v18.i11.1235