Copyright
©2008 The WJG Press and Baishideng.
World J Gastroenterol. Mar 28, 2008; 14(12): 1891-1897
Published online Mar 28, 2008. doi: 10.3748/wjg.14.1891
Published online Mar 28, 2008. doi: 10.3748/wjg.14.1891
Kit exon 9F tttggaaagctagtggttca | Kit exon 9R atggtagacagagcctaaac |
Kit exon11F ctatttttccctttctcccc | Kit exon11R tacccaaaaaggtgacatgg |
Kit exon 13F cttgacatcagtttgccag | Kit exon 13R aaaggcagcttggacacggcttta |
Kit exon 17F tttctcctccaacctaatag | Kit exon 17R cctttgcaggactgtcaagc |
PDGFRA exon 12aF ccagttacctgtcctggtcat | PDGFRA exon 12aR tggaaactcccatcttgagtc |
PDGFRA exon 12bF aaattcgctggagggtcatt | PDGFRA exon 12bR ggaggttaccccatggaagt |
PDGFR exon 18F agtgtgtccaccgtgatctg | PDGFRA exon 18R gtgtgggaagtgtggaggta |
- Citation: Kontogianni-Katsarou K, Dimitriadis E, Lariou C, Kairi-Vassilatou E, Pandis N, Kondi-Paphiti A. KIT exon 11 codon 557/558 deletion/insertion mutations define a subset of gastrointestinal stromal tumors with malignant potential. World J Gastroenterol 2008; 14(12): 1891-1897
- URL: https://www.wjgnet.com/1007-9327/full/v14/i12/1891.htm
- DOI: https://dx.doi.org/10.3748/wjg.14.1891