Copyright
©2007 Baishideng Publishing Group Co.
World J Gastroenterol. Dec 28, 2007; 13(48): 6581-6587
Published online Dec 28, 2007. doi: 10.3748/wjg.v13.i48.6581
Published online Dec 28, 2007. doi: 10.3748/wjg.v13.i48.6581
Table 1 Oligonucleotides sequences of β-catenin specific and negative control siRNA
Name | Sequence of siRNA | Target sites |
Pgenesil-CAT1 | AACAGTCTTACCTGGACTCTG | 0290-0310 |
Pgenesil-CAT2 | AAAGGCAATCCTGAGGAAGAG | 0355-0375 |
Pgenesil-Neg | GACTTCATAAGGCGCATGC | No homology |
- Citation: Huang WS, Wang JP, Wang T, Fang JY, Lan P, Ma JP. ShRNA-mediated gene silencing of β-catenin inhibits growth of human colon cancer cells. World J Gastroenterol 2007; 13(48): 6581-6587
- URL: https://www.wjgnet.com/1007-9327/full/v13/i48/6581.htm
- DOI: https://dx.doi.org/10.3748/wjg.v13.i48.6581