Basic Research
Copyright ©2007 Baishideng Publishing Group Inc.
World J Gastroenterol. Dec 21, 2007; 13(47): 6370-6378
Published online Dec 21, 2007. doi: 10.3748/wjg.v13.i47.6370
Table 3 Primers used for RT-PCR
Gene symbolGene ID (NCBI)Gene nameGene rolePrimerPrimer sequence 5’-3’
BMF90427Bcl2 modifying factor, transcript variant 1Has a single Bcl2 homology domain 3 (BH3), binds Bclk2 proteins and functions as an apoptotic activatorFGCTTCAGTTGCATTGCAGACCAGTT
RAGAGCCCTTGGGAATTCTCACCAT
CD24857124CD248 antigen = endosialinA gene regulated by the cell density in vitro. Has a calcium binding domainFTCAACTACGTTGGTGGCTTCGAGT
RAGTTGGGATAATGGGAAGCTGGGT
PPM1E22843Protein phosphatase 1EMember of the PP2C family of Ser/Thr phosphatases known to be negative regulators of stress response pathwaysFATGCCTCCATTCACCTCCACGTTA
RTGTCATAGAAGCCATCACAGGCCA
FXYD35349FXY domain containing ion transport reg. 3The protein encoded by this gene may function as a chloride channel or as a chloride channel regulatorFAATGCAAGTTTGGCCAGAAGTCCG
RTTGCATATGAGGTCCCATGGCTGA
OAS249392’-5’-oligoadenylate synthetase 2This enzyme family plays a significant role in the inhibition of cellular protein synthesisFAGAAGCCAACGTGACATCCTCGAT
RTGCTGGAGTTCAGTGAAGCAGACT
FY2532Duffy blood group antigenHelps in leukocyte recruitment to sites of inflammation by facilitating movement of chemokines across the endotheliumFTGACTCTGCACTGCCCTTCTTCAT
RTTGACAACAGCAACAGCTTGGACC
CERK64781Ceramide kinaseIntegral to membranes, has roles in arachidonic acid release and production of eicosanoidsFTGAGAAGAAACGGTGGTTGGGTCT
RAGCATTTCCGGATGAGGATGAGGT
HPSE10855HeparanaseCell surface expression and secretion markedly promote tumor angiogenesis and metastasisFACCTTTGCAGCTGGCTTTATGTGG
RCTTGCACGCTTGCCATTAACACCT
GAPDH2597Glyceraldehyde-3-phosphate dehydrogenaseUsed as referenceFGACCACAGTCCATGCCATCAC
RGAGCTTCAGAAAGTGGTCGTTGA