Copyright
©2007 Baishideng Publishing Group Inc.
World J Gastroenterol. Dec 14, 2007; 13(46): 6236-6242
Published online Dec 14, 2007. doi: 10.3748/wjg.v13.i46.6236
Published online Dec 14, 2007. doi: 10.3748/wjg.v13.i46.6236
Region | Primer direction | Sequence (5’ to 3’) | Nucleotide No |
ISDR | Outer sense | TGGATGGAGTGCGGTTGCACAGGTA | 6703-6727 |
Outer antisense | TGTAAAACGACGGCCAG | 7296-7320 | |
Inner sense | TCTTTCTCCGTGGAGGTGGTATTGC | 6722-6741 | |
Inner antisense | CAGGAAACAGCTATGACC | 7275-7294 | |
PePHD | Outer sense | TGACTACCCATACAGGCTCT | 2180-2199 |
Outer antisense | AAGGAAGGAGAGATTGCCAT | 2725-2744 | |
Inner sense | AAGGTTAGGATGTATGTGGG | 2238-2257 | |
Inner antisense | ATTGAGGACCACCGAGTTCT | 2689-2708 |
- Citation: Yoon J, Lee JI, Baik SK, Lee KH, Sohn JH, Lee HW, Namkung J, Chang SJ, Choi JW, Kim HW, Yeh BI. Predictive factors for interferon and ribavirin combination therapy in patients with chronic hepatitis C. World J Gastroenterol 2007; 13(46): 6236-6242
- URL: https://www.wjgnet.com/1007-9327/full/v13/i46/6236.htm
- DOI: https://dx.doi.org/10.3748/wjg.v13.i46.6236