Copyright
©2005 Baishideng Publishing Group Inc.
World J Gastroenterol. Mar 7, 2005; 11(9): 1283-1286
Published online Mar 7, 2005. doi: 10.3748/wjg.v11.i9.1283
Published online Mar 7, 2005. doi: 10.3748/wjg.v11.i9.1283
Primers | Sense primer (5’-3’) | Antisense primer (5’-3’) |
TEM-1 | gtggcttcgagtgttattg | gaagagctccggatatttg |
TEM-2 | agccatgatgaagactttgt | cttgaggtcactgttgacg |
TEM-6 | acccgtgacgtcattttc | tgtacttgcttcgagcatc |
TEM-7 | ggagcaggtcacgatgag | gtgaaactgcccttgtctt |
TEM-7R | cttgattggcagtatggagt | gagatgtacatggtcccact |
TEM-8 | catttcaagttgtcgtgaga | gacgcatattgttgttgaga |
- Citation: Rmali K, Puntis M, Jiang W. Prognostic values of tumor endothelial markers in patients with colorectal cancer. World J Gastroenterol 2005; 11(9): 1283-1286
- URL: https://www.wjgnet.com/1007-9327/full/v11/i9/1283.htm
- DOI: https://dx.doi.org/10.3748/wjg.v11.i9.1283