Copyright
©2005 Baishideng Publishing Group Inc.
World J Gastroenterol. Feb 28, 2005; 11(8): 1200-1203
Published online Feb 28, 2005. doi: 10.3748/wjg.v11.i8.1200
Published online Feb 28, 2005. doi: 10.3748/wjg.v11.i8.1200
Table 1 Primer sequences used for the amplification of HPV L1, HPV16 E6/E7, and HPV18 E6/E7 genes.
Target | Primer sequence | Approximate size (bp) |
HPV L1 gene(MY09) | 5' CGTCC{C/A}A{G/A}{G/A}GGA{T/A}ACTGATC 3’ | 450 |
HPV L1 gene (MY11) | 5' GC{C/A}CAGGG {T/A} CAT AA{T/C}AATGG 3’ | 450 |
HPV16 E6/E7 gene (sense) | 5' GAACAGCAATACAACAAACCCG 3’ | 240 |
HPV16 E6/E7 gene (antisense) | 5' CCATGCATGATTACAGCTGG 3’ | 240 |
HPV18 E6/E7 gene (sense) | 5' TGCCAGAAACCGTTGAATCC 3’ | 250 |
HPV18 E6/E7 gene (antisense) | 5' CAATGTCTTGCAATGTTGCC 3’ | 250 |
- Citation: Farhadi M, Tahmasebi Z, Merat S, Kamangar F, Nasrollahzadeh D, Malekzadeh R. Human papillomavirus in squamous cell carcinoma of esophagus in a high-risk population. World J Gastroenterol 2005; 11(8): 1200-1203
- URL: https://www.wjgnet.com/1007-9327/full/v11/i8/1200.htm
- DOI: https://dx.doi.org/10.3748/wjg.v11.i8.1200