Fumagillin treatment of hepatocellular carcinoma in rats: An in vivo study of antiangiogenesis

Table 1 Sequence of sense and antisense primers in reverse transcription-polymerase chain reaction (RT-PCR) analysis for MetAP-2, Bcl-2 and telomerase mRNA expression.

Name	Sequence	Direction	Expected product size (bp)	PCR conditions for pair of primers
MetAP-2-S	TGGCGGGCGTGGAAGAGG	Sense	282	1 cycles: 94 °C, 7 min 50 cycles: 94 °C, 40 s; 54 °C, 40; 72 °C, 1 min
MetAP-2-AS	GCACCATCACCATCACCATCTCC	Antisense	282	1 cycle: 72 °C, 10 min; 4 °C overnight
Bcl-2-S	AGATGAAGACTCCGCGCCCCTCAGG	Sense	566	1 cycles: 94 °C, 7 min 50 cycles: 94 °C, 40 s; 54 °C, 40; 72 °C, 1 min
Bcl-2-AS	CCAGGTATGCACCCAGAGTGATG	Antisense	566	1 cycles: 72 °C, 1 min; 4 °C overnight
Telomerase-S	GACATGGAGAACAAGCTGTTTGC	Sense	185	1 cycles: 94 °C, 7 min 50 cycles: 94 °C, 40 s; 54 °C, 40; 72 °C, 1 min
Telomerase-AS	ACAGGGAAGTTCACCACTGTC	Antisense	185	1 cycle: 72 °C, 10 min; 4 °C overnight
GAPDH-S	ACCACAGTCCATGCCATCAC	Sense	485	1 cycles: 94 °C, 7 min 50 cycles: 94 °C, 40 s; 54 °C, 40; 72 °C, 1 min
GAPDH-AS	TCCACCACCCTGTTGCTGTA	Antisense	485	1 cycle: 72 °C, 10 min; 4 °C overnight