Copyright
©2005 Baishideng Publishing Group Inc.
World J Gastroenterol. Nov 14, 2005; 11(42): 6644-6649
Published online Nov 14, 2005. doi: 10.3748/wjg.v11.i42.6644
Published online Nov 14, 2005. doi: 10.3748/wjg.v11.i42.6644
Table 1 Characteristics and nucleotide base sequences of primers used for nested PCR and control assays
Gene target | GenBankaccession number | Productsize (bp) | Sequences1 | Tm(°C) |
Outer sense agcagcgactctgaggcggagaccg | 69.1 | |||
450 | ||||
Outer antisense tgcgggtctgggggtcgttcacga | 71.4 | |||
HSV-1: RL2 | X14112 | Inner sense cccggcagttgcgggggcgc | 73.4 | |
110 | ||||
Inner antisense aaggtgtcgcagcggcaggtg | 60.8 | |||
b-actin | Forward gtgatctccttctgcatcc | 53.2 | ||
200 | 52.7 | |||
Reverse ctcttccagccttccttc |
-
Citation: Tsamakidis K, Panotopoulou E, Dimitroulopoulos D, Xinopoulos D, Christodoulou M, Papadokostopoulou A, Karagiannis I, Kouroumalis E, Paraskevas E. Herpes simplex virus type 1 in peptic ulcer disease: An inverse association with
Helicobacter pylori . World J Gastroenterol 2005; 11(42): 6644-6649 - URL: https://www.wjgnet.com/1007-9327/full/v11/i42/6644.htm
- DOI: https://dx.doi.org/10.3748/wjg.v11.i42.6644