Copyright
©2005 Baishideng Publishing Group Inc.
World J Gastroenterol. Apr 7, 2005; 11(13): 1929-1936
Published online Apr 7, 2005. doi: 10.3748/wjg.v11.i13.1929
Published online Apr 7, 2005. doi: 10.3748/wjg.v11.i13.1929
Table 3 LC Protocol 3 for Genotyping the TGF-β1 Gene Polymorphisms.
Codon 263 (Thr263Ile) | ||||
Time (s) | Temp (°C) | Transition Rate (°C/s) | Cycles | |
600 | 95 | 20 | 1 | Denaturation |
10 | 95 | 20 | 45 | Cycling |
10 | 59 | 20 | ||
20 | 72 | 20 | ||
60 | 95 | 20 | 1 | Melting curve |
Analysis | ||||
30 | 39 | 20 | ||
0 | 74 | 0.2 | ||
5-d(AAGCAGGGTTCACTACCGGC)-3’ | Sense primer | |||
5-d(AGGCCTCCATCCAGGCTACA)-3’ | Reverse primer | |||
5-LCRed640-(GAGAGGGCCCAGCATCTGCAAAGCT-P)-3 | Anchor primer | |||
5-d(ATGGCCACCCCGCT-Fluo)-3’ | Sensor primer |
- Citation: Wang H, Mengsteab S, Tag CG, Gao CF, Hellerbrand C, Lammert F, Gressner AM, Weiskirchen R. Transforming growth factor-β1 gene polymorphisms are associated with progression of liver fibrosis in Caucasians with chronic hepatitis C infection. World J Gastroenterol 2005; 11(13): 1929-1936
- URL: https://www.wjgnet.com/1007-9327/full/v11/i13/1929.htm
- DOI: https://dx.doi.org/10.3748/wjg.v11.i13.1929